EMAIL THIS PAGE TO A FRIEND

NRM

nurim (nuclear envelope membrane protein)

47 Gene Product Result for
Synonyms: NRM29
Gene ID:
Human(11270) Summary: The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Mouse(106582) nurim (nuclear envelope membrane protein)
Rat(361791) nurim (nuclear envelope membrane protein)
fruit fly(40515) neuromusculin
cow(511167) nurim (nuclear envelope membrane protein)
Zebrafish(570027) nurim (nuclear envelope membrane protein
domestic cat(101094848) nurim (nuclear envelope membrane protein)
dog(481707) nurim (nuclear envelope membrane protein)
naked mole-rat(101704434) nurim (nuclear envelope membrane protein)
domestic guinea pig(100722025) nurim (nuclear envelope membrane protein)
sheep(101102846) nurim (nuclear envelope membrane protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007243 Rosetta Predictions human pricing
NM_212508 Rosetta Predictions rat pricing
NM_134122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021644 predicted 1036
2 SASI_Hs01_00021645 predicted 269
3 SASI_Hs01_00021646 predicted 1043
4 SASI_Hs01_00021647 predicted 995
5 SASI_Hs01_00021648 predicted 735
6 SASI_Hs01_00021649 predicted 987
7 SASI_Hs01_00021650 predicted 835
8 SASI_Hs01_00021651 predicted 805
9 SASI_Hs01_00021652 predicted 1049
10 SASI_Hs01_00021653 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095542 predicted 483
2 SASI_Rn02_00270501 predicted 301
3 SASI_Rn01_00095543 predicted 553
4 SASI_Rn01_00095544 predicted 773
5 SASI_Rn01_00095548 predicted 958
6 SASI_Rn01_00095549 predicted 1060
7 SASI_Rn01_00095550 predicted 646
8 SASI_Rn01_00095551 predicted 981
9 SASI_Rn02_00270502 predicted 474
10 SASI_Rn02_00270503 predicted 1103
11 SASI_Rn01_00095545 predicted 1174
12 SASI_Rn01_00095546 predicted 1046
13 SASI_Rn01_00095547 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074310 predicted 1124
2 SASI_Mm01_00074311 predicted 847
3 SASI_Mm01_00074312 predicted 778
4 SASI_Mm01_00074313 predicted 1121
5 SASI_Mm01_00074314 predicted 757
6 SASI_Mm01_00074315 predicted 523
7 SASI_Mm01_00074316 predicted 841
8 SASI_Mm01_00074317 predicted 561
9 SASI_Mm01_00074318 predicted 1008
10 SASI_Mm01_00074319 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007243
VALIDATED
NRM MISSION shRNA Bacterial Glycerol Stock
nurim (nuclear envelope membrane protein)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007243.1-1208s21c1
Sequence:CCGGCTGCAAGTTCAACGGTCATAGCTCGAGCTATGACCGTTGAACTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-361s21c1
Sequence:CCGGTACTGGGAGCCCATACCCAAACTCGAGTTTGGGTATGGGCTCCCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-302s21c1
Sequence:CCGGTCCTTCAGAGGTCACTGTATGCTCGAGCATACAGTGACCTCTGAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-278s21c1
Sequence:CCGGCATGGACATCCCGGTACTTTGCTCGAGCAAAGTACCGGGATGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007243.1-83s1c1
Sequence:CCGGGAGTGGAGTTCGTGCGCTTTACTCGAGTAAAGCGCACGAACTCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220052    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007243.1-956s1c1
Sequence:CCGGGTCCAGCTCCATACCCTAAATCTCGAGATTTAGGGTATGGAGCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-476s21c1
Sequence:CCGGTTAGCATCCTTCTCGTCTTTGCTCGAGCAAAGACGAGAAGGATGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-511s21c1
Sequence:CCGGATGGGCCTCAAACAGGTATACCTCGAGGTATACCTGTTTGAGGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007243.1-885s21c1
Sequence:CCGGTTCATGCCAGAGGCCCAAATCCTCGAGGATTTGGGCCTCTGGCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-84s21c1
Sequence:CCGGAGTGGAGTTCGTGCGCTTTACCTCGAGGTAAAGCGCACGAACTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007243.1-465s1c1
Sequence:CCGGGCTCCTCATCTTTAGCATCCTCTCGAGAGGATGCTAAAGATGAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007243.1-468s1c1
Sequence:CCGGCCTCATCTTTAGCATCCTTCTCTCGAGAGAAGGATGCTAAAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007243.1-492s1c1
Sequence:CCGGCTTTGACTATGCTGAGCTCATCTCGAGATGAGCTCAGCATAGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007243
VALIDATED
NRM MISSION shRNA shRNA Plasmid DNA
nurim (nuclear envelope membrane protein)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007243.1-1208s21c1
Sequence:CCGGCTGCAAGTTCAACGGTCATAGCTCGAGCTATGACCGTTGAACTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-361s21c1
Sequence:CCGGTACTGGGAGCCCATACCCAAACTCGAGTTTGGGTATGGGCTCCCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-302s21c1
Sequence:CCGGTCCTTCAGAGGTCACTGTATGCTCGAGCATACAGTGACCTCTGAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-278s21c1
Sequence:CCGGCATGGACATCCCGGTACTTTGCTCGAGCAAAGTACCGGGATGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007243.1-83s1c1
Sequence:CCGGGAGTGGAGTTCGTGCGCTTTACTCGAGTAAAGCGCACGAACTCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220052    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007243.1-956s1c1
Sequence:CCGGGTCCAGCTCCATACCCTAAATCTCGAGATTTAGGGTATGGAGCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-476s21c1
Sequence:CCGGTTAGCATCCTTCTCGTCTTTGCTCGAGCAAAGACGAGAAGGATGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-511s21c1
Sequence:CCGGATGGGCCTCAAACAGGTATACCTCGAGGTATACCTGTTTGAGGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007243.1-885s21c1
Sequence:CCGGTTCATGCCAGAGGCCCAAATCCTCGAGGATTTGGGCCTCTGGCATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-84s21c1
Sequence:CCGGAGTGGAGTTCGTGCGCTTTACCTCGAGGTAAAGCGCACGAACTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007243.1-465s1c1
Sequence:CCGGGCTCCTCATCTTTAGCATCCTCTCGAGAGGATGCTAAAGATGAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007243.1-468s1c1
Sequence:CCGGCCTCATCTTTAGCATCCTTCTCTCGAGAGAAGGATGCTAAAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007243.1-492s1c1
Sequence:CCGGCTTTGACTATGCTGAGCTCATCTCGAGATGAGCTCAGCATAGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007243
VALIDATED
NRM MISSION shRNA Lentiviral Transduction Particles
nurim (nuclear envelope membrane protein)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007243.1-1208s21c1
Sequence:CCGGCTGCAAGTTCAACGGTCATAGCTCGAGCTATGACCGTTGAACTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-361s21c1
Sequence:CCGGTACTGGGAGCCCATACCCAAACTCGAGTTTGGGTATGGGCTCCCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-302s21c1
Sequence:CCGGTCCTTCAGAGGTCACTGTATGCTCGAGCATACAGTGACCTCTGAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-278s21c1
Sequence:CCGGCATGGACATCCCGGTACTTTGCTCGAGCAAAGTACCGGGATGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_007243.1-83s1c1
Sequence:CCGGGAGTGGAGTTCGTGCGCTTTACTCGAGTAAAGCGCACGAACTCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220052    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007243.1-956s1c1
Sequence:CCGGGTCCAGCTCCATACCCTAAATCTCGAGATTTAGGGTATGGAGCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-476s21c1
Sequence:CCGGTTAGCATCCTTCTCGTCTTTGCTCGAGCAAAGACGAGAAGGATGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-511s21c1
Sequence:CCGGATGGGCCTCAAACAGGTATACCTCGAGGTATACCTGTTTGAGGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007243.1-885s21c1
Sequence:CCGGTTCATGCCAGAGGCCCAAATCCTCGAGGATTTGGGCCTCTGGCATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007243.1-84s21c1
Sequence:CCGGAGTGGAGTTCGTGCGCTTTACCTCGAGGTAAAGCGCACGAACTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007243.1-465s1c1
Sequence:CCGGGCTCCTCATCTTTAGCATCCTCTCGAGAGGATGCTAAAGATGAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007243.1-468s1c1
Sequence:CCGGCCTCATCTTTAGCATCCTTCTCTCGAGAGAAGGATGCTAAAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007243.1-492s1c1
Sequence:CCGGCTTTGACTATGCTGAGCTCATCTCGAGATGAGCTCAGCATAGTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134122
VALIDATED
NRM MISSION shRNA Bacterial Glycerol Stock
nurim (nuclear envelope membrane protein)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-1065s21c1
Sequence:CCGGCCAGCCAAGAATGGTTACAAACTCGAGTTTGTAACCATTCTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-571s21c1
Sequence:CCGGGCAGGTTTATTACCATGTGCTCTCGAGAGCACATGGTAATAAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-541s21c1
Sequence:CCGGCTTTGACTACGCTGAACTGATCTCGAGATCAGTTCAGCGTAGTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-277s21c1
Sequence:CCGGGCTACTGTTTGTGGTACAGCACTCGAGTGCTGTACCACAAACAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134122.1-875s1c1
Sequence:CCGGCCCTGAATTTACTTCCCACCTCTCGAGAGGTGGGAAGTAAATTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134122.1-280s1c1
Sequence:CCGGGCTACTGTTTGTGGTACAGCACTCGAGTGCTGTACCACAAACAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134122.1-574s1c1
Sequence:CCGGGCAGGTTTATTACCATGTGCTCTCGAGAGCACATGGTAATAAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134122.1-544s1c1
Sequence:CCGGCTTTGACTACGCTGAACTGATCTCGAGATCAGTTCAGCGTAGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134122.1-1068s1c1
Sequence:CCGGCCAGCCAAGAATGGTTACAAACTCGAGTTTGTAACCATTCTTGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134122
VALIDATED
NRM MISSION shRNA shRNA Plasmid DNA
nurim (nuclear envelope membrane protein)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-1065s21c1
Sequence:CCGGCCAGCCAAGAATGGTTACAAACTCGAGTTTGTAACCATTCTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-571s21c1
Sequence:CCGGGCAGGTTTATTACCATGTGCTCTCGAGAGCACATGGTAATAAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-541s21c1
Sequence:CCGGCTTTGACTACGCTGAACTGATCTCGAGATCAGTTCAGCGTAGTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-277s21c1
Sequence:CCGGGCTACTGTTTGTGGTACAGCACTCGAGTGCTGTACCACAAACAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134122.1-875s1c1
Sequence:CCGGCCCTGAATTTACTTCCCACCTCTCGAGAGGTGGGAAGTAAATTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134122.1-280s1c1
Sequence:CCGGGCTACTGTTTGTGGTACAGCACTCGAGTGCTGTACCACAAACAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134122.1-574s1c1
Sequence:CCGGGCAGGTTTATTACCATGTGCTCTCGAGAGCACATGGTAATAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134122.1-544s1c1
Sequence:CCGGCTTTGACTACGCTGAACTGATCTCGAGATCAGTTCAGCGTAGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134122.1-1068s1c1
Sequence:CCGGCCAGCCAAGAATGGTTACAAACTCGAGTTTGTAACCATTCTTGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134122
VALIDATED
NRM MISSION shRNA Lentiviral Transduction Particles
nurim (nuclear envelope membrane protein)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-1065s21c1
Sequence:CCGGCCAGCCAAGAATGGTTACAAACTCGAGTTTGTAACCATTCTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-571s21c1
Sequence:CCGGGCAGGTTTATTACCATGTGCTCTCGAGAGCACATGGTAATAAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-541s21c1
Sequence:CCGGCTTTGACTACGCTGAACTGATCTCGAGATCAGTTCAGCGTAGTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134122.2-277s21c1
Sequence:CCGGGCTACTGTTTGTGGTACAGCACTCGAGTGCTGTACCACAAACAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134122.1-875s1c1
Sequence:CCGGCCCTGAATTTACTTCCCACCTCTCGAGAGGTGGGAAGTAAATTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134122.1-280s1c1
Sequence:CCGGGCTACTGTTTGTGGTACAGCACTCGAGTGCTGTACCACAAACAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134122.1-574s1c1
Sequence:CCGGGCAGGTTTATTACCATGTGCTCTCGAGAGCACATGGTAATAAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134122.1-544s1c1
Sequence:CCGGCTTTGACTACGCTGAACTGATCTCGAGATCAGTTCAGCGTAGTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134122.1-1068s1c1
Sequence:CCGGCCAGCCAAGAATGGTTACAAACTCGAGTTTGTAACCATTCTTGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)