EMAIL THIS PAGE TO A FRIEND

NRN1

neuritin 1

105 Gene Product Result for
Synonyms: NRN dJ380B8.2
UniProtKB ID: Q9NPD7, B2RA93, Q7Z4Y1
Gene ID:
Human(51299) Summary: This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(68404) neuritin 1
Rat(83834) neuritin 1
sheep(101108869) neuritin 1
chicken(420873) neuritin 1
cow(538730) neuritin 1
dog(612757) neuritin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4101 Anti-Neuritin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900369 Anti-NRN1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016588 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016588 Rosetta Predictions human pricing
NM_053346 Rosetta Predictions rat pricing
NM_153529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041972 predicted 905
2 SASI_Hs01_00041973 predicted 1134
3 SASI_Hs01_00041974 predicted 840
4 SASI_Hs01_00041975 predicted 1106
5 SASI_Hs01_00041977 predicted 873
6 SASI_Hs01_00041980 predicted 826
7 SASI_Hs01_00041978 predicted 951
8 SASI_Hs01_00041979 predicted 733
9 SASI_Hs01_00041976 predicted 1050
10 SASI_Hs01_00041981 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045422 predicted 437
2 SASI_Rn01_00045423 predicted 445
3 SASI_Rn01_00045424 predicted 409
4 SASI_Rn01_00045425 predicted 377
5 SASI_Rn01_00045426 predicted 482
6 SASI_Rn01_00045427 predicted 442
7 SASI_Rn01_00045428 predicted 271
8 SASI_Rn01_00045429 predicted 267
9 SASI_Rn02_00265803 predicted 365
10 SASI_Rn02_00265804 predicted 199
11 SASI_Rn01_00045430 predicted 269
12 SASI_Rn01_00045431 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041534 predicted 258
2 SASI_Mm01_00041535 predicted 308
3 SASI_Mm01_00041536 predicted 252
4 SASI_Mm01_00041537 predicted 253
5 SASI_Mm01_00041538 predicted 366
6 SASI_Mm01_00041540 predicted 252
7 SASI_Mm01_00041541 predicted 239
8 SASI_Mm01_00041542 predicted 243
9 SASI_Mm01_00041539 predicted 208
10 SASI_Mm01_00041543 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153529
VALIDATED
NRN1 MISSION shRNA Bacterial Glycerol Stock
neuritin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-262s1c1
Sequence:CCGGCAAGTGTGATGCAGTCTTTAACTCGAGTTAAAGACTGCATCACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-1391s1c1
Sequence:CCGGCACATACAGTAATACCTGAATCTCGAGATTCAGGTATTACTGTATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-1384s1c1
Sequence:CCGGGCTGTTACACATACAGTAATACTCGAGTATTACTGTATGTGTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153529.1-224s1c1
Sequence:CCGGCAAATAGCTTACCTGGTGCAGCTCGAGCTGCACCAGGTAAGCTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-435s1c1
Sequence:CCGGCGAAAGATATGTGGGATAAACCTCGAGGTTTATCCCACATATCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-672s1c1
Sequence:CCGGCGAGAGGAATAGCCATTCGTTCTCGAGAACGAATGGCTATTCCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-478s1c1
Sequence:CCGGCAACATCCAAGGCAGCTTATTCTCGAGAATAAGCTGCCTTGGATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-989s1c1
Sequence:CCGGGCCACCTACTATATTAATCATCTCGAGATGATTAATATAGTAGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-223s1c1
Sequence:CCGGGCAAATAGCTTACCTGGTGCACTCGAGTGCACCAGGTAAGCTATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153529
VALIDATED
NRN1 MISSION shRNA shRNA Plasmid DNA
neuritin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-262s1c1
Sequence:CCGGCAAGTGTGATGCAGTCTTTAACTCGAGTTAAAGACTGCATCACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-1391s1c1
Sequence:CCGGCACATACAGTAATACCTGAATCTCGAGATTCAGGTATTACTGTATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-1384s1c1
Sequence:CCGGGCTGTTACACATACAGTAATACTCGAGTATTACTGTATGTGTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153529.1-224s1c1
Sequence:CCGGCAAATAGCTTACCTGGTGCAGCTCGAGCTGCACCAGGTAAGCTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-435s1c1
Sequence:CCGGCGAAAGATATGTGGGATAAACCTCGAGGTTTATCCCACATATCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-672s1c1
Sequence:CCGGCGAGAGGAATAGCCATTCGTTCTCGAGAACGAATGGCTATTCCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-478s1c1
Sequence:CCGGCAACATCCAAGGCAGCTTATTCTCGAGAATAAGCTGCCTTGGATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-989s1c1
Sequence:CCGGGCCACCTACTATATTAATCATCTCGAGATGATTAATATAGTAGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-223s1c1
Sequence:CCGGGCAAATAGCTTACCTGGTGCACTCGAGTGCACCAGGTAAGCTATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153529
VALIDATED
NRN1 MISSION shRNA Lentiviral Transduction Particles
neuritin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-262s1c1
Sequence:CCGGCAAGTGTGATGCAGTCTTTAACTCGAGTTAAAGACTGCATCACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-1391s1c1
Sequence:CCGGCACATACAGTAATACCTGAATCTCGAGATTCAGGTATTACTGTATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-1384s1c1
Sequence:CCGGGCTGTTACACATACAGTAATACTCGAGTATTACTGTATGTGTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153529.1-224s1c1
Sequence:CCGGCAAATAGCTTACCTGGTGCAGCTCGAGCTGCACCAGGTAAGCTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-435s1c1
Sequence:CCGGCGAAAGATATGTGGGATAAACCTCGAGGTTTATCCCACATATCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-672s1c1
Sequence:CCGGCGAGAGGAATAGCCATTCGTTCTCGAGAACGAATGGCTATTCCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-478s1c1
Sequence:CCGGCAACATCCAAGGCAGCTTATTCTCGAGAATAAGCTGCCTTGGATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-989s1c1
Sequence:CCGGGCCACCTACTATATTAATCATCTCGAGATGATTAATATAGTAGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153529.1-223s1c1
Sequence:CCGGGCAAATAGCTTACCTGGTGCACTCGAGTGCACCAGGTAAGCTATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016588
NRN1 MISSION shRNA Bacterial Glycerol Stock
neuritin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-684s1c1
Sequence:CCGGACTGATCCTCGCGGTGCAAATCTCGAGATTTGCACCGCGAGGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-1053s1c1
Sequence:CCGGAGCTTTAGCGACCTGGCTTTCCTCGAGGAAAGCCAGGTCGCTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-834s1c1
Sequence:CCGGCATCAAGACCGTGTGCACATACTCGAGTATGTGCACACGGTCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-820s1c1
Sequence:CCGGGACGACAAGACGAACATCAAGCTCGAGCTTGATGTTCGTCTTGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016588.2-1138s1c1
Sequence:CCGGCGAGAGGAAGATCCATTAGTTCTCGAGAACTAATGGATCTTCCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-912s1c1
Sequence:CCGGGAAAGATATGTGGGATAAACTCTCGAGAGTTTATCCCACATATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-916s1c1
Sequence:CCGGGATATGTGGGATAAACTGAGACTCGAGTCTCAGTTTATCCCACATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-961s1c1
Sequence:CCGGCAAGGCAGCTTATTCGAACTCCTCGAGGAGTTCGAATAAGCTGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016588.2-1535s1c1
Sequence:CCGGCGGACGAAACATACGGTGAATCTCGAGATTCACCGTATGTTTCGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-960s1c1
Sequence:CCGGCCAAGGCAGCTTATTCGAACTCTCGAGAGTTCGAATAAGCTGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016588
NRN1 MISSION shRNA shRNA Plasmid DNA
neuritin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-684s1c1
Sequence:CCGGACTGATCCTCGCGGTGCAAATCTCGAGATTTGCACCGCGAGGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-1053s1c1
Sequence:CCGGAGCTTTAGCGACCTGGCTTTCCTCGAGGAAAGCCAGGTCGCTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-834s1c1
Sequence:CCGGCATCAAGACCGTGTGCACATACTCGAGTATGTGCACACGGTCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-820s1c1
Sequence:CCGGGACGACAAGACGAACATCAAGCTCGAGCTTGATGTTCGTCTTGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016588.2-1138s1c1
Sequence:CCGGCGAGAGGAAGATCCATTAGTTCTCGAGAACTAATGGATCTTCCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-912s1c1
Sequence:CCGGGAAAGATATGTGGGATAAACTCTCGAGAGTTTATCCCACATATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-916s1c1
Sequence:CCGGGATATGTGGGATAAACTGAGACTCGAGTCTCAGTTTATCCCACATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-961s1c1
Sequence:CCGGCAAGGCAGCTTATTCGAACTCCTCGAGGAGTTCGAATAAGCTGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016588.2-1535s1c1
Sequence:CCGGCGGACGAAACATACGGTGAATCTCGAGATTCACCGTATGTTTCGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-960s1c1
Sequence:CCGGCCAAGGCAGCTTATTCGAACTCTCGAGAGTTCGAATAAGCTGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016588
NRN1 MISSION shRNA Lentiviral Transduction Particles
neuritin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-684s1c1
Sequence:CCGGACTGATCCTCGCGGTGCAAATCTCGAGATTTGCACCGCGAGGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-1053s1c1
Sequence:CCGGAGCTTTAGCGACCTGGCTTTCCTCGAGGAAAGCCAGGTCGCTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-834s1c1
Sequence:CCGGCATCAAGACCGTGTGCACATACTCGAGTATGTGCACACGGTCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-820s1c1
Sequence:CCGGGACGACAAGACGAACATCAAGCTCGAGCTTGATGTTCGTCTTGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016588.2-1138s1c1
Sequence:CCGGCGAGAGGAAGATCCATTAGTTCTCGAGAACTAATGGATCTTCCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-912s1c1
Sequence:CCGGGAAAGATATGTGGGATAAACTCTCGAGAGTTTATCCCACATATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-916s1c1
Sequence:CCGGGATATGTGGGATAAACTGAGACTCGAGTCTCAGTTTATCCCACATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-961s1c1
Sequence:CCGGCAAGGCAGCTTATTCGAACTCCTCGAGGAGTTCGAATAAGCTGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016588.2-1535s1c1
Sequence:CCGGCGGACGAAACATACGGTGAATCTCGAGATTCACCGTATGTTTCGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016588.2-960s1c1
Sequence:CCGGCCAAGGCAGCTTATTCGAACTCTCGAGAGTTCGAATAAGCTGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)