EMAIL THIS PAGE TO A FRIEND

NRP2

neuropilin 2

378 Gene Product Result for
Synonyms: NP2 NPN2 PRO2714 VEGF165R2
Gene ID:
Human(8828) Summary: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(18187) neuropilin 2
Rat(81527) neuropilin 2
Thale Cress(838462) NAP1-related protein 2
cow(541004) neuropilin 2
Horse(100066305) neuropilin 2
dog(488487) neuropilin 2
chicken(374157) neuropilin 2
sheep(100135449) neuropilin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003872 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058801 MISSION® esiRNA esiRNA human NRP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003872 Rosetta Predictions human pricing
NM_018534 Rosetta Predictions human pricing
NM_201264 Rosetta Predictions human pricing
NM_201266 Rosetta Predictions human pricing
NM_201267 Rosetta Predictions human pricing
NM_201279 Rosetta Predictions human pricing
NM_030869 Rosetta Predictions rat pricing
NM_001077403 Rosetta Predictions mouse pricing
NM_001077404 Rosetta Predictions mouse pricing
NM_001077405 Rosetta Predictions mouse pricing
NM_001077406 Rosetta Predictions mouse pricing
NM_001077407 Rosetta Predictions mouse pricing
NM_010939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085996 predicted 1034
2 SASI_Hs01_00085997 predicted 1839
3 SASI_Hs01_00085998 predicted 1953
4 SASI_Hs01_00085999 predicted 1598
5 SASI_Hs01_00086000 predicted 1577
6 SASI_Hs01_00086001 predicted 1463
7 SASI_Hs01_00086002 predicted 1299
8 SASI_Hs01_00086003 predicted 1660
9 SASI_Hs01_00086004 predicted 1946
10 SASI_Hs01_00086005 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121617 predicted 1036
2 SASI_Hs01_00121618 predicted 1839
3 SASI_Hs01_00121619 predicted 1956
4 SASI_Hs01_00121620 predicted 1600
5 SASI_Hs01_00121621 predicted 1570
6 SASI_Hs01_00121622 predicted 1469
7 SASI_Hs01_00121623 predicted 1297
8 SASI_Hs01_00121624 predicted 1655
9 SASI_Hs01_00121625 predicted 1947
10 SASI_Hs01_00121626 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168032 predicted 1033
2 SASI_Hs01_00168033 predicted 1843
3 SASI_Hs01_00168034 predicted 1953
4 SASI_Hs01_00168035 predicted 1598
5 SASI_Hs01_00168036 predicted 1572
6 SASI_Hs01_00168037 predicted 1463
7 SASI_Hs01_00168038 predicted 1301
8 SASI_Hs01_00168039 predicted 1661
9 SASI_Hs01_00168040 predicted 1946
10 SASI_Hs01_00168041 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172646 predicted 1034
2 SASI_Hs01_00172647 predicted 1838
3 SASI_Hs01_00172648 predicted 1957
4 SASI_Hs01_00172649 predicted 1596
5 SASI_Hs01_00172650 predicted 1578
6 SASI_Hs01_00172651 predicted 1468
7 SASI_Hs01_00172652 predicted 1300
8 SASI_Hs01_00172653 predicted 1664
9 SASI_Hs01_00172654 predicted 1938
10 SASI_Hs01_00172655 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142641 predicted 1029
2 SASI_Hs01_00142642 predicted 1838
3 SASI_Hs01_00142643 predicted 1956
4 SASI_Hs01_00142644 predicted 1603
5 SASI_Hs01_00142645 predicted 1577
6 SASI_Hs01_00142646 predicted 1471
7 SASI_Hs01_00142647 predicted 1298
8 SASI_Hs01_00142648 predicted 1660
9 SASI_Hs01_00142649 predicted 1945
10 SASI_Hs01_00142650 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190597 predicted 1036
2 SASI_Hs01_00190598 predicted 1843
3 SASI_Hs01_00190599 predicted 1951
4 SASI_Hs01_00190600 predicted 1601
5 SASI_Hs01_00190601 predicted 1570
6 SASI_Hs01_00190602 predicted 1466
7 SASI_Hs01_00190603 predicted 1296
8 SASI_Hs01_00190604 predicted 1663
9 SASI_Hs01_00190605 predicted 1943
10 SASI_Hs01_00190606 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032721 predicted 2544
2 SASI_Rn01_00032723 predicted 2560
3 SASI_Rn01_00032724 predicted 666
4 SASI_Rn01_00032725 predicted 478
5 SASI_Rn01_00032726 predicted 2613
6 SASI_Rn01_00032727 predicted 2360
7 SASI_Rn01_00032728 predicted 1573
8 SASI_Rn01_00032730 predicted 772
9 SASI_Rn02_00264130 predicted 785
10 SASI_Rn02_00264131 predicted 2732
11 SASI_Rn01_00032722 predicted 2766
12 SASI_Rn01_00032729 predicted 2683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292582 predicted 2032
2 SASI_Mm02_00292583 predicted 1830
3 SASI_Mm02_00292584 predicted 1937
4 SASI_Mm02_00292585 predicted 2303
5 SASI_Mm02_00292586 predicted 1095
6 SASI_Mm02_00292587 predicted 2025
7 SASI_Mm02_00292588 predicted 1280
8 SASI_Mm02_00292589 predicted 1711
9 SASI_Mm02_00292590 predicted 1844
10 SASI_Mm02_00292591 predicted 1992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292592 predicted 2029
2 SASI_Mm02_00292593 predicted 1830
3 SASI_Mm02_00292594 predicted 1944
4 SASI_Mm02_00292595 predicted 2306
5 SASI_Mm02_00292596 predicted 1091
6 SASI_Mm02_00292597 predicted 2025
7 SASI_Mm02_00292598 predicted 1277
8 SASI_Mm02_00292599 predicted 1707
9 SASI_Mm02_00292600 predicted 1841
10 SASI_Mm02_00292601 predicted 1990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292602 predicted 2029
2 SASI_Mm02_00292603 predicted 1827
3 SASI_Mm02_00292604 predicted 1938
4 SASI_Mm02_00292605 predicted 2303
5 SASI_Mm02_00292606 predicted 1091
6 SASI_Mm02_00292607 predicted 2021
7 SASI_Mm02_00292608 predicted 1280
8 SASI_Mm02_00292609 predicted 1711
9 SASI_Mm02_00292610 predicted 1844
10 SASI_Mm02_00292611 predicted 1991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292612 predicted 2032
2 SASI_Mm02_00292613 predicted 1826
3 SASI_Mm02_00292614 predicted 1937
4 SASI_Mm02_00292615 predicted 2302
5 SASI_Mm02_00292616 predicted 1093
6 SASI_Mm02_00292617 predicted 2019
7 SASI_Mm02_00292618 predicted 1283
8 SASI_Mm02_00292619 predicted 1714
9 SASI_Mm02_00292620 predicted 1837
10 SASI_Mm02_00292621 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292622 predicted 2032
2 SASI_Mm02_00292623 predicted 3256
3 SASI_Mm02_00292624 predicted 1821
4 SASI_Mm02_00292625 predicted 1944
5 SASI_Mm02_00292626 predicted 1092
6 SASI_Mm02_00292627 predicted 3174
7 SASI_Mm02_00292628 predicted 1285
8 SASI_Mm02_00292629 predicted 1714
9 SASI_Mm02_00292630 predicted 1839
10 SASI_Mm02_00292631 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054736 predicted 2032
2 SASI_Mm01_00054739 predicted 1823
3 SASI_Mm02_00319694 predicted 1943
4 SASI_Mm02_00319695 predicted 2299
5 SASI_Mm01_00054740 predicted 1095
6 SASI_Mm02_00319696 predicted 2024
7 SASI_Mm01_00054742 predicted 1278
8 SASI_Mm01_00054743 predicted 1710
9 SASI_Mm01_00054744 predicted 1843
10 SASI_Mm02_00319697 predicted 1987
11 SASI_Mm01_00054737 predicted 2812
12 SASI_Mm01_00054738 predicted 2907
13 SASI_Mm01_00054741 predicted 2826
14 SASI_Mm01_00054745 predicted 2986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010939
VALIDATED
NRP2 MISSION shRNA Bacterial Glycerol Stock
neuropilin 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000028974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-756s1c1
Sequence:CCGGCCTCACTTTGAAATCGAGAAACTCGAGTTTCTCGATTTCAAAGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-1032s1c1
Sequence:CCGGCCAGAGAAGTATCCACACAATCTCGAGATTGTGTGGATACTTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-2356s1c1
Sequence:CCGGCCGTGAAGAGTGAAGAGACTACTCGAGTAGTCTCTTCACTCTTCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-1394s1c1
Sequence:CCGGCCGGATTGCTAATGAACAGATCTCGAGATCTGTTCATTAGCAATCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010939
VALIDATED
NRP2 MISSION shRNA shRNA Plasmid DNA
neuropilin 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000028974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-756s1c1
Sequence:CCGGCCTCACTTTGAAATCGAGAAACTCGAGTTTCTCGATTTCAAAGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-1032s1c1
Sequence:CCGGCCAGAGAAGTATCCACACAATCTCGAGATTGTGTGGATACTTCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-2356s1c1
Sequence:CCGGCCGTGAAGAGTGAAGAGACTACTCGAGTAGTCTCTTCACTCTTCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-1394s1c1
Sequence:CCGGCCGGATTGCTAATGAACAGATCTCGAGATCTGTTCATTAGCAATCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010939
VALIDATED
NRP2 MISSION shRNA Lentiviral Transduction Particles
neuropilin 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000028974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-756s1c1
Sequence:CCGGCCTCACTTTGAAATCGAGAAACTCGAGTTTCTCGATTTCAAAGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-1032s1c1
Sequence:CCGGCCAGAGAAGTATCCACACAATCTCGAGATTGTGTGGATACTTCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-2356s1c1
Sequence:CCGGCCGTGAAGAGTGAAGAGACTACTCGAGTAGTCTCTTCACTCTTCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010939.1-1394s1c1
Sequence:CCGGCCGGATTGCTAATGAACAGATCTCGAGATCTGTTCATTAGCAATCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003872
VALIDATED
NRP2 MISSION shRNA Bacterial Glycerol Stock
neuropilin 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-3144s1c1
Sequence:CCGGGCCATTGATGACATTCGGATACTCGAGTATCCGAATGTCATCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-1034s1c1
Sequence:CCGGCGACTGCAAGTATGACTTTATCTCGAGATAAAGTCATACTTGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-2827s1c1
Sequence:CCGGCGTTTCCAGATGACAGGAATTCTCGAGAATTCCTGTCATCTGGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-998s1c1
Sequence:CCGGCCTCAACTTCAACCCTCACTTCTCGAGAAGTGAGGGTTGAAGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-2354s1c1
Sequence:CCGGGCGCAAGTTCAAAGTCTCCTACTCGAGTAGGAGACTTTGAACTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003872
VALIDATED
NRP2 MISSION shRNA shRNA Plasmid DNA
neuropilin 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-3144s1c1
Sequence:CCGGGCCATTGATGACATTCGGATACTCGAGTATCCGAATGTCATCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-1034s1c1
Sequence:CCGGCGACTGCAAGTATGACTTTATCTCGAGATAAAGTCATACTTGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-2827s1c1
Sequence:CCGGCGTTTCCAGATGACAGGAATTCTCGAGAATTCCTGTCATCTGGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-998s1c1
Sequence:CCGGCCTCAACTTCAACCCTCACTTCTCGAGAAGTGAGGGTTGAAGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-2354s1c1
Sequence:CCGGGCGCAAGTTCAAAGTCTCCTACTCGAGTAGGAGACTTTGAACTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003872
VALIDATED
NRP2 MISSION shRNA Lentiviral Transduction Particles
neuropilin 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-3144s1c1
Sequence:CCGGGCCATTGATGACATTCGGATACTCGAGTATCCGAATGTCATCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-1034s1c1
Sequence:CCGGCGACTGCAAGTATGACTTTATCTCGAGATAAAGTCATACTTGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-2827s1c1
Sequence:CCGGCGTTTCCAGATGACAGGAATTCTCGAGAATTCCTGTCATCTGGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-998s1c1
Sequence:CCGGCCTCAACTTCAACCCTCACTTCTCGAGAAGTGAGGGTTGAAGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003872.2-2354s1c1
Sequence:CCGGGCGCAAGTTCAAAGTCTCCTACTCGAGTAGGAGACTTTGAACTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)