EMAIL THIS PAGE TO A FRIEND

NRROS

negative regulator of reactive oxygen species

59 Gene Product Result for
Synonyms: GARPL1 LRRC33 UNQ3030
Gene ID:
Mouse(224109) negative regulator of reactive oxygen species
Rat(303875) negative regulator of reactive oxygen species
Zebrafish(445318) negative regulator of reactive oxygen species
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198565 Rosetta Predictions human pricing
NM_001024995 Rosetta Predictions rat pricing
NM_146069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162328 predicted 1166
2 SASI_Hs01_00162329 predicted 1106
3 SASI_Hs01_00162330 predicted 299
4 SASI_Hs01_00162332 predicted 663
5 SASI_Hs02_00372187 predicted 298
6 SASI_Hs02_00372188 predicted 953
7 SASI_Hs02_00372189 predicted 1083
8 SASI_Hs01_00162335 predicted 1004
9 SASI_Hs02_00372190 predicted 522
10 SASI_Hs02_00372191 predicted 1484
11 SASI_Hs01_00162326 predicted 1400
12 SASI_Hs01_00162327 predicted 1682
13 SASI_Hs01_00162331 predicted 1867
14 SASI_Hs01_00162333 predicted 1870
15 SASI_Hs01_00162334 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065645 predicted 487
2 SASI_Rn01_00065646 predicted 1535
3 SASI_Rn01_00065647 predicted 722
4 SASI_Rn01_00065648 predicted 1368
5 SASI_Rn01_00065649 predicted 752
6 SASI_Rn01_00065650 predicted 290
7 SASI_Rn01_00065652 predicted 1579
8 SASI_Rn01_00065653 predicted 1612
9 SASI_Rn02_00202892 predicted 1745
10 SASI_Rn01_00065654 predicted 659
11 SASI_Rn01_00065651 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100438 predicted 2572
2 SASI_Mm01_00100439 predicted 1860
3 SASI_Mm02_00341690 predicted 2563
4 SASI_Mm01_00100440 predicted 1607
5 SASI_Mm01_00100441 predicted 2208
6 SASI_Mm01_00100442 predicted 1690
7 SASI_Mm01_00100443 predicted 1830
8 SASI_Mm01_00100444 predicted 2186
9 SASI_Mm01_00100445 predicted 3023
10 SASI_Mm01_00100446 predicted 1757
11 SASI_Mm01_00100447 predicted 1475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198565
NRROS MISSION shRNA Bacterial Glycerol Stock
negative regulator of reactive oxygen species
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-1679s1c1
Sequence:CCGGCAGCTTTATGGCGTTGGACTTCTCGAGAAGTCCAACGCCATAAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-668s1c1
Sequence:CCGGGCAGAGGAACTACATCTTCGACTCGAGTCGAAGATGTAGTTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-1465s1c1
Sequence:CCGGGCTGTGTGGATTTCAGGAATACTCGAGTATTCCTGAAATCCACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-1967s1c1
Sequence:CCGGCAACCTCTCCTCCAAGATCATCTCGAGATGATCTTGGAGGAGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-674s1c1
Sequence:CCGGGAACTACATCTTCGAGATCGACTCGAGTCGATCTCGAAGATGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198565.1-2263s21c1
Sequence:CCGGGAGGCCAAGTCTGACGAATTGCTCGAGCAATTCGTCAGACTTGGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198565.1-1788s21c1
Sequence:CCGGACCCTGGATCTCCGTAGAAACCTCGAGGTTTCTACGGAGATCCAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198565.1-1192s21c1
Sequence:CCGGGCCTGATGACGCTTCACATTCCTCGAGGAATGTGAAGCGTCATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198565
NRROS MISSION shRNA shRNA Plasmid DNA
negative regulator of reactive oxygen species
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-1679s1c1
Sequence:CCGGCAGCTTTATGGCGTTGGACTTCTCGAGAAGTCCAACGCCATAAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-668s1c1
Sequence:CCGGGCAGAGGAACTACATCTTCGACTCGAGTCGAAGATGTAGTTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-1465s1c1
Sequence:CCGGGCTGTGTGGATTTCAGGAATACTCGAGTATTCCTGAAATCCACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-1967s1c1
Sequence:CCGGCAACCTCTCCTCCAAGATCATCTCGAGATGATCTTGGAGGAGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-674s1c1
Sequence:CCGGGAACTACATCTTCGAGATCGACTCGAGTCGATCTCGAAGATGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198565.1-2263s21c1
Sequence:CCGGGAGGCCAAGTCTGACGAATTGCTCGAGCAATTCGTCAGACTTGGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198565.1-1788s21c1
Sequence:CCGGACCCTGGATCTCCGTAGAAACCTCGAGGTTTCTACGGAGATCCAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198565.1-1192s21c1
Sequence:CCGGGCCTGATGACGCTTCACATTCCTCGAGGAATGTGAAGCGTCATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198565
NRROS MISSION shRNA Lentiviral Transduction Particles
negative regulator of reactive oxygen species
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-1679s1c1
Sequence:CCGGCAGCTTTATGGCGTTGGACTTCTCGAGAAGTCCAACGCCATAAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-668s1c1
Sequence:CCGGGCAGAGGAACTACATCTTCGACTCGAGTCGAAGATGTAGTTCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-1465s1c1
Sequence:CCGGGCTGTGTGGATTTCAGGAATACTCGAGTATTCCTGAAATCCACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-1967s1c1
Sequence:CCGGCAACCTCTCCTCCAAGATCATCTCGAGATGATCTTGGAGGAGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198565.1-674s1c1
Sequence:CCGGGAACTACATCTTCGAGATCGACTCGAGTCGATCTCGAAGATGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198565.1-2263s21c1
Sequence:CCGGGAGGCCAAGTCTGACGAATTGCTCGAGCAATTCGTCAGACTTGGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198565.1-1788s21c1
Sequence:CCGGACCCTGGATCTCCGTAGAAACCTCGAGGTTTCTACGGAGATCCAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198565.1-1192s21c1
Sequence:CCGGGCCTGATGACGCTTCACATTCCTCGAGGAATGTGAAGCGTCATCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146069
NRROS MISSION shRNA Bacterial Glycerol Stock
negative regulator of reactive oxygen species
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-2566s1c1
Sequence:CCGGCGACATGAGTCACAATCAGATCTCGAGATCTGATTGTGACTCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-2858s1c1
Sequence:CCGGGAGATGGACTTCTCTGCGTTTCTCGAGAAACGCAGAGAAGTCCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-1678s1c1
Sequence:CCGGGAGACTGGACTTGTCTGGAAACTCGAGTTTCCAGACAAGTCCAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-2584s1c1
Sequence:CCGGGATCTCACTTTGTCCTCAGATCTCGAGATCTGAGGACAAAGTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146069
NRROS MISSION shRNA shRNA Plasmid DNA
negative regulator of reactive oxygen species
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-2566s1c1
Sequence:CCGGCGACATGAGTCACAATCAGATCTCGAGATCTGATTGTGACTCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-2858s1c1
Sequence:CCGGGAGATGGACTTCTCTGCGTTTCTCGAGAAACGCAGAGAAGTCCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-1678s1c1
Sequence:CCGGGAGACTGGACTTGTCTGGAAACTCGAGTTTCCAGACAAGTCCAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-2584s1c1
Sequence:CCGGGATCTCACTTTGTCCTCAGATCTCGAGATCTGAGGACAAAGTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146069
NRROS MISSION shRNA Lentiviral Transduction Particles
negative regulator of reactive oxygen species
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-2566s1c1
Sequence:CCGGCGACATGAGTCACAATCAGATCTCGAGATCTGATTGTGACTCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-2858s1c1
Sequence:CCGGGAGATGGACTTCTCTGCGTTTCTCGAGAAACGCAGAGAAGTCCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-1678s1c1
Sequence:CCGGGAGACTGGACTTGTCTGGAAACTCGAGTTTCCAGACAAGTCCAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146069.2-2584s1c1
Sequence:CCGGGATCTCACTTTGTCCTCAGATCTCGAGATCTGAGGACAAAGTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)