EMAIL THIS PAGE TO A FRIEND

NRSN1

neurensin 1

187 Gene Product Result for
Synonyms: VMP p24
UniProtKB ID: Q8IZ57, B2RAV4, Q8N8R6, Q96P21
Gene ID:
Mouse(22360) neurensin 1
Rat(291129) neurensin 1
Zebrafish(335551) neurensin 1
cow(510831) neurensin 1
chicken(420822) neurensin 1
dog(478734) neurensin 1
sheep(101119514) neurensin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080723 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080723 Rosetta Predictions human pricing
NM_001106109 Rosetta Predictions rat pricing
NM_009513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105027 predicted 1097
2 SASI_Hs01_00105028 predicted 467
3 SASI_Hs01_00105029 predicted 717
4 SASI_Hs01_00105030 predicted 498
5 SASI_Hs01_00105031 predicted 1033
6 SASI_Hs01_00105032 predicted 1089
7 SASI_Hs01_00105033 predicted 411
8 SASI_Hs01_00105034 predicted 1170
9 SASI_Hs02_00362503 predicted 1085
10 SASI_Hs01_00105035 predicted 922
11 SASI_Hs01_00105036 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215712 predicted 732
2 SASI_Rn02_00215713 predicted 775
3 SASI_Rn02_00215714 predicted 1031
4 SASI_Rn02_00215715 predicted 403
5 SASI_Rn02_00215716 predicted 367
6 SASI_Rn02_00215717 predicted 413
7 SASI_Rn02_00215718 predicted 435
8 SASI_Rn02_00215719 predicted 680
9 SASI_Rn02_00215720 predicted 1016
10 SASI_Rn02_00215721 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316306 predicted 1055
2 SASI_Mm02_00316307 predicted 803
3 SASI_Mm01_00081201 predicted 1195
4 SASI_Mm01_00081202 predicted 426
5 SASI_Mm02_00316308 predicted 800
6 SASI_Mm02_00316309 predicted 922
7 SASI_Mm01_00081204 predicted 388
8 SASI_Mm02_00316310 predicted 447
9 SASI_Mm02_00316311 predicted 458
10 SASI_Mm02_00316312 predicted 949
11 SASI_Mm01_00081200 predicted 497
12 SASI_Mm01_00081203 predicted 1086
13 SASI_Mm01_00081205 predicted 314
14 SASI_Mm01_00081206 predicted 1080
15 SASI_Mm01_00081207 predicted 237
16 SASI_Mm01_00081208 predicted 408
17 SASI_Mm01_00081209 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080723
NRSN1 MISSION shRNA Bacterial Glycerol Stock
neurensin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080723.4-510s21c1
Sequence:CCGGAGCATTTGGCGAAGCCGATTTCTCGAGAAATCGGCTTCGCCAAATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080723.4-932s21c1
Sequence:CCGGGTTCAGCTGTGGGCAATATAACTCGAGTTATATTGCCCACAGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080723.4-1097s21c1
Sequence:CCGGGATCGTGACTTTGTGTTATTTCTCGAGAAATAACACAAAGTCACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080723.4-430s21c1
Sequence:CCGGGGACTCATCTCAGGTACAGTTCTCGAGAACTGTACCTGAGATGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080723.4-853s21c1
Sequence:CCGGCTGATTTATGCCCGTGGTTAACTCGAGTTAACCACGGGCATAAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-618s1c1
Sequence:CCGGGACACACATGCTGTCCAGTTTCTCGAGAAACTGGACAGCATGTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-716s1c1
Sequence:CCGGGCTGATGTCGGTGTTTGTAAACTCGAGTTTACAAACACCGACATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-447s1c1
Sequence:CCGGGAGGATGATTTCCAGATCCAACTCGAGTTGGATCTGGAAATCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-458s1c1
Sequence:CCGGCCAGATCCAAAGATCACCTAACTCGAGTTAGGTGATCTTTGGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080723
NRSN1 MISSION shRNA shRNA Plasmid DNA
neurensin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080723.4-510s21c1
Sequence:CCGGAGCATTTGGCGAAGCCGATTTCTCGAGAAATCGGCTTCGCCAAATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080723.4-932s21c1
Sequence:CCGGGTTCAGCTGTGGGCAATATAACTCGAGTTATATTGCCCACAGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080723.4-1097s21c1
Sequence:CCGGGATCGTGACTTTGTGTTATTTCTCGAGAAATAACACAAAGTCACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080723.4-430s21c1
Sequence:CCGGGGACTCATCTCAGGTACAGTTCTCGAGAACTGTACCTGAGATGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080723.4-853s21c1
Sequence:CCGGCTGATTTATGCCCGTGGTTAACTCGAGTTAACCACGGGCATAAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-618s1c1
Sequence:CCGGGACACACATGCTGTCCAGTTTCTCGAGAAACTGGACAGCATGTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-716s1c1
Sequence:CCGGGCTGATGTCGGTGTTTGTAAACTCGAGTTTACAAACACCGACATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-447s1c1
Sequence:CCGGGAGGATGATTTCCAGATCCAACTCGAGTTGGATCTGGAAATCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-458s1c1
Sequence:CCGGCCAGATCCAAAGATCACCTAACTCGAGTTAGGTGATCTTTGGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080723
NRSN1 MISSION shRNA Lentiviral Transduction Particles
neurensin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080723.4-510s21c1
Sequence:CCGGAGCATTTGGCGAAGCCGATTTCTCGAGAAATCGGCTTCGCCAAATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080723.4-932s21c1
Sequence:CCGGGTTCAGCTGTGGGCAATATAACTCGAGTTATATTGCCCACAGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080723.4-1097s21c1
Sequence:CCGGGATCGTGACTTTGTGTTATTTCTCGAGAAATAACACAAAGTCACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080723.4-430s21c1
Sequence:CCGGGGACTCATCTCAGGTACAGTTCTCGAGAACTGTACCTGAGATGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080723.4-853s21c1
Sequence:CCGGCTGATTTATGCCCGTGGTTAACTCGAGTTAACCACGGGCATAAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-618s1c1
Sequence:CCGGGACACACATGCTGTCCAGTTTCTCGAGAAACTGGACAGCATGTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-716s1c1
Sequence:CCGGGCTGATGTCGGTGTTTGTAAACTCGAGTTTACAAACACCGACATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-447s1c1
Sequence:CCGGGAGGATGATTTCCAGATCCAACTCGAGTTGGATCTGGAAATCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080723.2-458s1c1
Sequence:CCGGCCAGATCCAAAGATCACCTAACTCGAGTTAGGTGATCTTTGGATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009513
NRSN1 MISSION shRNA Bacterial Glycerol Stock
neurensin 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-448s21c1
Sequence:CCGGCTTTGTGATTCTCGGACTAACCTCGAGGTTAGTCCGAGAATCACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-725s21c1
Sequence:CCGGCATACCCAGCCCATCACTAAACTCGAGTTTAGTGATGGGCTGGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-702s21c1
Sequence:CCGGAGCGAATCGCAGACATTAAAGCTCGAGCTTTAATGTCTGCGATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009513.2-1187s21c1
Sequence:CCGGGCTGTCTTCCATGCCTATTTCCTCGAGGAAATAGGCATGGAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-358s21c1
Sequence:CCGGCTGGGAGTATGAGGATGATTTCTCGAGAAATCATCCTCATACTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009513.1-606s1c1
Sequence:CCGGGCCAAGAGCTATTCCAAAGAACTCGAGTTCTTTGGAATAGCTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009513.1-1573s1c1
Sequence:CCGGCCTGAGGATCTTGTGATGGTTCTCGAGAACCATCACAAGATCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009513.1-399s1c1
Sequence:CCGGGTCTTTGTGATTCTCGGACTACTCGAGTAGTCCGAGAATCACAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009513
NRSN1 MISSION shRNA shRNA Plasmid DNA
neurensin 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-448s21c1
Sequence:CCGGCTTTGTGATTCTCGGACTAACCTCGAGGTTAGTCCGAGAATCACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-725s21c1
Sequence:CCGGCATACCCAGCCCATCACTAAACTCGAGTTTAGTGATGGGCTGGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-702s21c1
Sequence:CCGGAGCGAATCGCAGACATTAAAGCTCGAGCTTTAATGTCTGCGATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009513.2-1187s21c1
Sequence:CCGGGCTGTCTTCCATGCCTATTTCCTCGAGGAAATAGGCATGGAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-358s21c1
Sequence:CCGGCTGGGAGTATGAGGATGATTTCTCGAGAAATCATCCTCATACTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009513.1-606s1c1
Sequence:CCGGGCCAAGAGCTATTCCAAAGAACTCGAGTTCTTTGGAATAGCTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009513.1-1573s1c1
Sequence:CCGGCCTGAGGATCTTGTGATGGTTCTCGAGAACCATCACAAGATCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009513.1-399s1c1
Sequence:CCGGGTCTTTGTGATTCTCGGACTACTCGAGTAGTCCGAGAATCACAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009513
NRSN1 MISSION shRNA Lentiviral Transduction Particles
neurensin 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-448s21c1
Sequence:CCGGCTTTGTGATTCTCGGACTAACCTCGAGGTTAGTCCGAGAATCACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-725s21c1
Sequence:CCGGCATACCCAGCCCATCACTAAACTCGAGTTTAGTGATGGGCTGGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-702s21c1
Sequence:CCGGAGCGAATCGCAGACATTAAAGCTCGAGCTTTAATGTCTGCGATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009513.2-1187s21c1
Sequence:CCGGGCTGTCTTCCATGCCTATTTCCTCGAGGAAATAGGCATGGAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009513.2-358s21c1
Sequence:CCGGCTGGGAGTATGAGGATGATTTCTCGAGAAATCATCCTCATACTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009513.1-606s1c1
Sequence:CCGGGCCAAGAGCTATTCCAAAGAACTCGAGTTCTTTGGAATAGCTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009513.1-1573s1c1
Sequence:CCGGCCTGAGGATCTTGTGATGGTTCTCGAGAACCATCACAAGATCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009513.1-399s1c1
Sequence:CCGGGTCTTTGTGATTCTCGGACTACTCGAGTAGTCCGAGAATCACAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)