EMAIL THIS PAGE TO A FRIEND

NRTN

neurturin

56 Gene Product Result for
Synonyms: NTN
UniProtKB ID: Q99748, B2RPE8
Gene ID:
Human(4902) Summary: Neurturin is a member of the TGF-beta subfamily, TRN. This gene signals through RET and a GPI-linked coreceptor, and promotes survival of neuronal populations. A neurturin mutation has been described in a family with Hirschsprung Disease. [provided by RefSeq, Jul 2008]
Mouse(18188) neurturin
Rat(84423) neurturin
chicken(428340) neurturin
dog(611764) neurturin
cow(525562) neurturin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004558 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004558 Rosetta Predictions human pricing
NM_053399 Rosetta Predictions rat pricing
NM_008738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021994 predicted 853
2 SASI_Hs01_00021995 predicted 854
3 SASI_Hs01_00021996 predicted 360
4 SASI_Hs01_00021997 predicted 364
5 SASI_Hs01_00021998 predicted 1059
6 SASI_Hs02_00337881 predicted 936
7 SASI_Hs01_00021999 predicted 1019
8 SASI_Hs01_00022000 predicted 1050
9 SASI_Hs01_00022001 predicted 521
10 SASI_Hs01_00022002 predicted 481
11 SASI_Hs01_00022003 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071086 predicted 393
2 SASI_Rn01_00071087 predicted 446
3 SASI_Rn01_00071088 predicted 192
4 SASI_Rn02_00265901 predicted 331
5 SASI_Rn01_00071089 predicted 343
6 SASI_Rn01_00071090 predicted 294
7 SASI_Rn01_00071091 predicted 437
8 SASI_Rn01_00071092 predicted 384
9 SASI_Rn01_00071093 predicted 395
10 SASI_Rn01_00071094 predicted 304
11 SASI_Rn01_00071095 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194128 predicted 737
2 SASI_Mm02_00314595 predicted 539
3 SASI_Mm01_00194129 predicted 367
4 SASI_Mm01_00194132 predicted 690
5 SASI_Mm01_00194133 predicted 365
6 SASI_Mm01_00194135 predicted 395
7 SASI_Mm02_00314596 predicted 772
8 SASI_Mm01_00194136 predicted 634
9 SASI_Mm01_00194137 predicted 787
10 SASI_Mm02_00314597 predicted 504
11 SASI_Mm01_00194130 predicted 543
12 SASI_Mm01_00194131 predicted 372
13 SASI_Mm01_00194134 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004558
NRTN MISSION shRNA Bacterial Glycerol Stock
neurturin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-518s21c1
Sequence:CCGGCCTGGCCCAGTACCGTGCACTCTCGAGAGTGCACGGTACTGGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-423s21c1
Sequence:CCGGATGTGTCGAGAGGGCCTGCTTCTCGAGAAGCAGGCCCTCTCGACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-945s21c1
Sequence:CCGGTGCGTGTGACCCTACCTCACTCTCGAGAGTGAGGTAGGGTCACACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-404s1c2
Sequence:CCGGCTCCGTGCTGTCCATCTGGATCTCGAGATCCAGATGGACAGCACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-409s21c1
Sequence:CCGGTGCTGTCCATCTGGATGTGTCCTCGAGGACACATCCAGATGGACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-719s1c1
Sequence:CCGGGTCCGACGAGACGGTGCTGTTCTCGAGAACAGCACCGTCTCGTCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-902s1c1
Sequence:CCGGCCGCTACCACACGGTGCACGACTCGAGTCGTGCACCGTGTGGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-862s1c1
Sequence:CCGGCGGCCTACGAGGACGAGGTGTCTCGAGACACCTCGTCCTCGTAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-404s1c1
Sequence:CCGGCTCCGTGCTGTCCATCTGGATCTCGAGATCCAGATGGACAGCACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-392s21c1
Sequence:CCGGAGTGCTCTGCAGCTCCGTGCTCTCGAGAGCACGGAGCTGCAGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004558
NRTN MISSION shRNA shRNA Plasmid DNA
neurturin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-518s21c1
Sequence:CCGGCCTGGCCCAGTACCGTGCACTCTCGAGAGTGCACGGTACTGGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-423s21c1
Sequence:CCGGATGTGTCGAGAGGGCCTGCTTCTCGAGAAGCAGGCCCTCTCGACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-945s21c1
Sequence:CCGGTGCGTGTGACCCTACCTCACTCTCGAGAGTGAGGTAGGGTCACACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-404s1c2
Sequence:CCGGCTCCGTGCTGTCCATCTGGATCTCGAGATCCAGATGGACAGCACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-409s21c1
Sequence:CCGGTGCTGTCCATCTGGATGTGTCCTCGAGGACACATCCAGATGGACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-719s1c1
Sequence:CCGGGTCCGACGAGACGGTGCTGTTCTCGAGAACAGCACCGTCTCGTCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-902s1c1
Sequence:CCGGCCGCTACCACACGGTGCACGACTCGAGTCGTGCACCGTGTGGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-862s1c1
Sequence:CCGGCGGCCTACGAGGACGAGGTGTCTCGAGACACCTCGTCCTCGTAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-404s1c1
Sequence:CCGGCTCCGTGCTGTCCATCTGGATCTCGAGATCCAGATGGACAGCACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-392s21c1
Sequence:CCGGAGTGCTCTGCAGCTCCGTGCTCTCGAGAGCACGGAGCTGCAGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004558
NRTN MISSION shRNA Lentiviral Transduction Particles
neurturin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-518s21c1
Sequence:CCGGCCTGGCCCAGTACCGTGCACTCTCGAGAGTGCACGGTACTGGGCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-423s21c1
Sequence:CCGGATGTGTCGAGAGGGCCTGCTTCTCGAGAAGCAGGCCCTCTCGACACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-945s21c1
Sequence:CCGGTGCGTGTGACCCTACCTCACTCTCGAGAGTGAGGTAGGGTCACACGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-404s1c2
Sequence:CCGGCTCCGTGCTGTCCATCTGGATCTCGAGATCCAGATGGACAGCACGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-409s21c1
Sequence:CCGGTGCTGTCCATCTGGATGTGTCCTCGAGGACACATCCAGATGGACAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-719s1c1
Sequence:CCGGGTCCGACGAGACGGTGCTGTTCTCGAGAACAGCACCGTCTCGTCGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-902s1c1
Sequence:CCGGCCGCTACCACACGGTGCACGACTCGAGTCGTGCACCGTGTGGTAGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-862s1c1
Sequence:CCGGCGGCCTACGAGGACGAGGTGTCTCGAGACACCTCGTCCTCGTAGGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004558.2-404s1c1
Sequence:CCGGCTCCGTGCTGTCCATCTGGATCTCGAGATCCAGATGGACAGCACGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004558.3-392s21c1
Sequence:CCGGAGTGCTCTGCAGCTCCGTGCTCTCGAGAGCACGGAGCTGCAGAGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008738
VALIDATED
NRTN MISSION shRNA Bacterial Glycerol Stock
neurturin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-395s1c1
Sequence:CCGGCCCTGCTATCTGTCTGGATGTCTCGAGACATCCAGACAGATAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008738.1-845s1c1
Sequence:CCGGCGGCCTATGAGGACGAGGTGTCTCGAGACACCTCGTCCTCATAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-547s1c1
Sequence:CCGGGCGGTGGAGCTTCGAGAACTTCTCGAGAAGTTCTCGAAGCTCCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-690s1c1
Sequence:CCGGCCTGGGCTACACGTCGGATGACTCGAGTCATCCGACGTGTAGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-757s1c1
Sequence:CCGGCGCATCTACGACCTGGGCCTTCTCGAGAAGGCCCAGGTCGTAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008738
VALIDATED
NRTN MISSION shRNA shRNA Plasmid DNA
neurturin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-395s1c1
Sequence:CCGGCCCTGCTATCTGTCTGGATGTCTCGAGACATCCAGACAGATAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008738.1-845s1c1
Sequence:CCGGCGGCCTATGAGGACGAGGTGTCTCGAGACACCTCGTCCTCATAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-547s1c1
Sequence:CCGGGCGGTGGAGCTTCGAGAACTTCTCGAGAAGTTCTCGAAGCTCCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-690s1c1
Sequence:CCGGCCTGGGCTACACGTCGGATGACTCGAGTCATCCGACGTGTAGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-757s1c1
Sequence:CCGGCGCATCTACGACCTGGGCCTTCTCGAGAAGGCCCAGGTCGTAGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008738
VALIDATED
NRTN MISSION shRNA Lentiviral Transduction Particles
neurturin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-395s1c1
Sequence:CCGGCCCTGCTATCTGTCTGGATGTCTCGAGACATCCAGACAGATAGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008738.1-845s1c1
Sequence:CCGGCGGCCTATGAGGACGAGGTGTCTCGAGACACCTCGTCCTCATAGGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-547s1c1
Sequence:CCGGGCGGTGGAGCTTCGAGAACTTCTCGAGAAGTTCTCGAAGCTCCACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-690s1c1
Sequence:CCGGCCTGGGCTACACGTCGGATGACTCGAGTCATCCGACGTGTAGCCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008738.1-757s1c1
Sequence:CCGGCGCATCTACGACCTGGGCCTTCTCGAGAAGGCCCAGGTCGTAGATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)