EMAIL THIS PAGE TO A FRIEND

NRXN1

neurexin 1

199 Gene Product Result for
Synonyms: Hs.22998 PTHSL2 SCZD17
UniProtKB ID: P58400
Gene ID:
Human(9378) Summary: Neurexins function in the vertebrate nervous system as cell adhesion molecules and receptors. Two neurexin genes are among the largest known in human (NRXN1 and NRXN3). By using alternate promoters, splice sites and exons, predictions of hundreds or even thousands of distinct mRNAs have been made. Most transcripts use the upstream promoter and encode alpha-neurexin isoforms; fewer transcripts are produced from the downstream promoter and encode beta-neurexin isoforms. Alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and they interact with neurexophilins. Beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. The RefSeq Project has decided to create only a few representative transcript variants of the multitude that are possible. [provided by RefSeq, Oct 2008]
Mouse(18189) neurexin I
Rat(60391) neurexin 1
chicken(395398) neurexin 1
Horse(100052908) neurexin 1
cow(281950) neurexin 1
dog(474589) neurexin 1
sheep(101104646) neurexin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138735 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123051 MISSION® esiRNA esiRNA human NRXN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004801 Rosetta Predictions human pricing
NM_138735 Rosetta Predictions human pricing
NM_021767 Rosetta Predictions rat pricing
NM_020252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338336 predicted 5076
2 SASI_Hs01_00157556 predicted 5453
3 SASI_Hs02_00338337 predicted 5104
4 SASI_Hs02_00338338 predicted 5071
5 SASI_Hs01_00157559 predicted 5340
6 SASI_Hs02_00338339 predicted 5285
7 SASI_Hs02_00338340 predicted 5085
8 SASI_Hs02_00338341 predicted 5415
9 SASI_Hs02_00338342 predicted 5055
10 SASI_Hs02_00338343 predicted 5085
11 SASI_Hs01_00157551 predicted 4223
12 SASI_Hs01_00157552 predicted 4262
13 SASI_Hs01_00157553 predicted 3949
14 SASI_Hs01_00157554 predicted 4344
15 SASI_Hs01_00157555 predicted 4346
16 SASI_Hs01_00157557 predicted 4494
17 SASI_Hs01_00157558 predicted 4351
18 SASI_Hs01_00157560 predicted 4470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363843 predicted 1299
2 SASI_Hs01_00109080 predicted 1683
3 SASI_Hs02_00363844 predicted 1328
4 SASI_Hs02_00363845 predicted 1294
5 SASI_Hs01_00109083 predicted 1567
6 SASI_Hs02_00363846 predicted 1509
7 SASI_Hs02_00363847 predicted 1309
8 SASI_Hs02_00363848 predicted 1644
9 SASI_Hs02_00363849 predicted 1274
10 SASI_Hs02_00363850 predicted 1307
11 SASI_Hs01_00109075 predicted 1732
12 SASI_Hs01_00109076 predicted 1768
13 SASI_Hs01_00109077 predicted 1451
14 SASI_Hs01_00109078 predicted 1858
15 SASI_Hs01_00109079 predicted 1863
16 SASI_Hs01_00109081 predicted 2011
17 SASI_Hs01_00109082 predicted 1856
18 SASI_Hs01_00109084 predicted 1988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088937 predicted 3666
2 SASI_Rn02_00262829 predicted 4676
3 SASI_Rn01_00088939 predicted 3655
4 SASI_Rn01_00088940 predicted 4113
5 SASI_Rn02_00262830 predicted 1623
6 SASI_Rn02_00262831 predicted 2156
7 SASI_Rn01_00088941 predicted 2567
8 SASI_Rn01_00088942 predicted 3140
9 SASI_Rn01_00088943 predicted 3352
10 SASI_Rn01_00088944 predicted 4222
11 SASI_Rn01_00088938 predicted 3963
12 SASI_Rn01_00088945 predicted 1759
13 SASI_Rn01_00088946 predicted 3200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325421 predicted 3451
2 SASI_Mm02_00325422 predicted 3732
3 SASI_Mm02_00325423 predicted 3875
4 SASI_Mm02_00325424 predicted 4422
5 SASI_Mm02_00325425 predicted 2155
6 SASI_Mm02_00325426 predicted 4657
7 SASI_Mm02_00325427 predicted 3861
8 SASI_Mm02_00325428 predicted 2766
9 SASI_Mm02_00325429 predicted 3549
10 SASI_Mm02_00325430 predicted 4685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020252
NRXN1 MISSION shRNA Bacterial Glycerol Stock
neurexin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020252.1-3747s1c1
Sequence:CCGGCAAGATTTGAAACGGACACTTCTCGAGAAGTGTCCGTTTCAAATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-1626s1c1
Sequence:CCGGGCTGGCTATAACCTCAATGATCTCGAGATCATTGAGGTTATAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-2765s1c1
Sequence:CCGGGCTGCACATACACCAAGGAAACTCGAGTTTCCTTGGTGTATGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-1551s1c1
Sequence:CCGGCGTGTGAAACTCACGGTCAATCTCGAGATTGACCGTGAGTTTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-2829s1c1
Sequence:CCGGGAAGAGTCTAATGCAATCATTCTCGAGAATGATTGCATTAGACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020252
NRXN1 MISSION shRNA shRNA Plasmid DNA
neurexin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020252.1-3747s1c1
Sequence:CCGGCAAGATTTGAAACGGACACTTCTCGAGAAGTGTCCGTTTCAAATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-1626s1c1
Sequence:CCGGGCTGGCTATAACCTCAATGATCTCGAGATCATTGAGGTTATAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-2765s1c1
Sequence:CCGGGCTGCACATACACCAAGGAAACTCGAGTTTCCTTGGTGTATGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-1551s1c1
Sequence:CCGGCGTGTGAAACTCACGGTCAATCTCGAGATTGACCGTGAGTTTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-2829s1c1
Sequence:CCGGGAAGAGTCTAATGCAATCATTCTCGAGAATGATTGCATTAGACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020252
NRXN1 MISSION shRNA Lentiviral Transduction Particles
neurexin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020252.1-3747s1c1
Sequence:CCGGCAAGATTTGAAACGGACACTTCTCGAGAAGTGTCCGTTTCAAATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-1626s1c1
Sequence:CCGGGCTGGCTATAACCTCAATGATCTCGAGATCATTGAGGTTATAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-2765s1c1
Sequence:CCGGGCTGCACATACACCAAGGAAACTCGAGTTTCCTTGGTGTATGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-1551s1c1
Sequence:CCGGCGTGTGAAACTCACGGTCAATCTCGAGATTGACCGTGAGTTTCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020252.1-2829s1c1
Sequence:CCGGGAAGAGTCTAATGCAATCATTCTCGAGAATGATTGCATTAGACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138735
NRXN1 MISSION shRNA Bacterial Glycerol Stock
neurexin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138735.1-2430s1c1
Sequence:CCGGCGCACGCATTCATAAAGCAAACTCGAGTTTGCTTTATGAATGCGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138735.1-1298s1c1
Sequence:CCGGCCATTGAAGAATCCAATGCAACTCGAGTTGCATTGGATTCTTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138735.1-2512s1c1
Sequence:CCGGGCTACCTATGATCCTGGATTTCTCGAGAAATCCAGGATCATAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138735.1-2053s1c1
Sequence:CCGGGCTGTTGTAAAGGAGAAACAACTCGAGTTGTTTCTCCTTTACAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138735.1-1293s1c1
Sequence:CCGGCATCGCCATTGAAGAATCCAACTCGAGTTGGATTCTTCAATGGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138735
NRXN1 MISSION shRNA shRNA Plasmid DNA
neurexin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138735.1-2430s1c1
Sequence:CCGGCGCACGCATTCATAAAGCAAACTCGAGTTTGCTTTATGAATGCGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138735.1-1298s1c1
Sequence:CCGGCCATTGAAGAATCCAATGCAACTCGAGTTGCATTGGATTCTTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138735.1-2512s1c1
Sequence:CCGGGCTACCTATGATCCTGGATTTCTCGAGAAATCCAGGATCATAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138735.1-2053s1c1
Sequence:CCGGGCTGTTGTAAAGGAGAAACAACTCGAGTTGTTTCTCCTTTACAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138735.1-1293s1c1
Sequence:CCGGCATCGCCATTGAAGAATCCAACTCGAGTTGGATTCTTCAATGGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138735
NRXN1 MISSION shRNA Lentiviral Transduction Particles
neurexin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138735.1-2430s1c1
Sequence:CCGGCGCACGCATTCATAAAGCAAACTCGAGTTTGCTTTATGAATGCGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138735.1-1298s1c1
Sequence:CCGGCCATTGAAGAATCCAATGCAACTCGAGTTGCATTGGATTCTTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138735.1-2512s1c1
Sequence:CCGGGCTACCTATGATCCTGGATTTCTCGAGAAATCCAGGATCATAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138735.1-2053s1c1
Sequence:CCGGGCTGTTGTAAAGGAGAAACAACTCGAGTTGTTTCTCCTTTACAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138735.1-1293s1c1
Sequence:CCGGCATCGCCATTGAAGAATCCAACTCGAGTTGGATTCTTCAATGGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)