EMAIL THIS PAGE TO A FRIEND

NRXN2

neurexin 2

148 Gene Product Result for
UniProtKB ID: P58401
Gene ID:
Human(9379) Summary: This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
Mouse(18190) neurexin II
Rat(116595) neurexin 2
dog(483760) neurexin 2
cow(537808) neurexin 2
sheep(101117889) neurexin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051470 Anti-NRXN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015080 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152691 MISSION® esiRNA esiRNA human NRXN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015080 Rosetta Predictions human pricing
NM_138732 Rosetta Predictions human pricing
NM_138734 Rosetta Predictions human pricing
NM_053846 Rosetta Predictions rat pricing
NM_020253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112393 predicted 5446
2 SASI_Hs01_00112395 predicted 5448
3 SASI_Hs01_00112396 predicted 5401
4 SASI_Hs01_00112398 predicted 5370
5 SASI_Hs01_00112399 predicted 5366
6 SASI_Hs01_00112400 predicted 5392
7 SASI_Hs01_00112401 predicted 5371
8 SASI_Hs01_00112402 predicted 5372
9 SASI_Hs02_00346949 predicted 5362
10 SASI_Hs02_00346950 predicted 5371
11 SASI_Hs01_00112394 predicted 5378
12 SASI_Hs01_00112397 predicted 5432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154974 predicted 5234
2 SASI_Hs01_00154976 predicted 5233
3 SASI_Hs01_00154977 predicted 5189
4 SASI_Hs01_00154979 predicted 5163
5 SASI_Hs01_00154980 predicted 5151
6 SASI_Hs01_00154981 predicted 5178
7 SASI_Hs01_00154982 predicted 5160
8 SASI_Hs01_00154983 predicted 5161
9 SASI_Hs02_00363838 predicted 5155
10 SASI_Hs02_00363839 predicted 5162
11 SASI_Hs01_00154975 predicted 5174
12 SASI_Hs01_00154978 predicted 5223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045189 predicted 2374
2 SASI_Hs01_00045191 predicted 2379
3 SASI_Hs01_00045192 predicted 2331
4 SASI_Hs01_00045194 predicted 2302
5 SASI_Hs01_00045195 predicted 2304
6 SASI_Hs01_00045196 predicted 2320
7 SASI_Hs01_00045197 predicted 2310
8 SASI_Hs01_00045198 predicted 2300
9 SASI_Hs02_00363841 predicted 2298
10 SASI_Hs02_00363842 predicted 2303
11 SASI_Hs01_00045190 predicted 2309
12 SASI_Hs01_00045193 predicted 2371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266697 predicted 1757
2 SASI_Rn01_00114004 predicted 4826
3 SASI_Rn01_00114005 predicted 2577
4 SASI_Rn01_00114007 predicted 5337
5 SASI_Rn01_00114008 predicted 2405
6 SASI_Rn01_00114009 predicted 1588
7 SASI_Rn01_00114010 predicted 5343
8 SASI_Rn01_00114012 predicted 2419
9 SASI_Rn01_00114013 predicted 3168
10 SASI_Rn02_00266698 predicted 2892
11 SASI_Rn01_00114006 predicted 3302
12 SASI_Rn01_00114011 predicted 3162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170426 predicted 2212
2 SASI_Mm01_00170427 predicted 3079
3 SASI_Mm01_00170428 predicted 2203
4 SASI_Mm01_00170429 predicted 2680
5 SASI_Mm01_00170430 predicted 2368
6 SASI_Mm01_00170431 predicted 2983
7 SASI_Mm01_00170432 predicted 3412
8 SASI_Mm01_00170434 predicted 3454
9 SASI_Mm01_00170435 predicted 2704
10 SASI_Mm02_00325431 predicted 2707
11 SASI_Mm01_00170433 predicted 3407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015080
NRXN2 MISSION shRNA Bacterial Glycerol Stock
neurexin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015080.2-5833s21c1
Sequence:CCGGCTCACAGCCCTGGGTTGATTTCTCGAGAAATCAACCCAGGGCTGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-5548s1c1
Sequence:CCGGGAAGAACAAAGACAAGGAGTACTCGAGTACTCCTTGTCTTTGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-1531s1c1
Sequence:CCGGCAATGGCAAGTTCAACGACAACTCGAGTTGTCGTTGAACTTGCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-3259s1c1
Sequence:CCGGGCACCTCTTCTTCCAGTTCAACTCGAGTTGAACTGGAAGAAGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-4092s1c1
Sequence:CCGGCCATAGTAAGCGACGGCAAATCTCGAGATTTGCCGTCGCTTACTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-1308s1c1
Sequence:CCGGCGACCTTCAAAGGCAATGAGTCTCGAGACTCATTGCCTTTGAAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015080.2-1789s21c1
Sequence:CCGGCCTCAAGGACGTGGTCTATAACTCGAGTTATAGACCACGTCCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015080
NRXN2 MISSION shRNA shRNA Plasmid DNA
neurexin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015080.2-5833s21c1
Sequence:CCGGCTCACAGCCCTGGGTTGATTTCTCGAGAAATCAACCCAGGGCTGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-5548s1c1
Sequence:CCGGGAAGAACAAAGACAAGGAGTACTCGAGTACTCCTTGTCTTTGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-1531s1c1
Sequence:CCGGCAATGGCAAGTTCAACGACAACTCGAGTTGTCGTTGAACTTGCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-3259s1c1
Sequence:CCGGGCACCTCTTCTTCCAGTTCAACTCGAGTTGAACTGGAAGAAGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-4092s1c1
Sequence:CCGGCCATAGTAAGCGACGGCAAATCTCGAGATTTGCCGTCGCTTACTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-1308s1c1
Sequence:CCGGCGACCTTCAAAGGCAATGAGTCTCGAGACTCATTGCCTTTGAAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015080.2-1789s21c1
Sequence:CCGGCCTCAAGGACGTGGTCTATAACTCGAGTTATAGACCACGTCCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015080
NRXN2 MISSION shRNA Lentiviral Transduction Particles
neurexin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015080.2-5833s21c1
Sequence:CCGGCTCACAGCCCTGGGTTGATTTCTCGAGAAATCAACCCAGGGCTGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-5548s1c1
Sequence:CCGGGAAGAACAAAGACAAGGAGTACTCGAGTACTCCTTGTCTTTGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-1531s1c1
Sequence:CCGGCAATGGCAAGTTCAACGACAACTCGAGTTGTCGTTGAACTTGCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-3259s1c1
Sequence:CCGGGCACCTCTTCTTCCAGTTCAACTCGAGTTGAACTGGAAGAAGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-4092s1c1
Sequence:CCGGCCATAGTAAGCGACGGCAAATCTCGAGATTTGCCGTCGCTTACTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015080.2-1308s1c1
Sequence:CCGGCGACCTTCAAAGGCAATGAGTCTCGAGACTCATTGCCTTTGAAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015080.2-1789s21c1
Sequence:CCGGCCTCAAGGACGTGGTCTATAACTCGAGTTATAGACCACGTCCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020253
NRXN2 MISSION shRNA Bacterial Glycerol Stock
neurexin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-1753s1c1
Sequence:CCGGCGCAAGGTCAATGATGGTGAACTCGAGTTCACCATCATTGACCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-2683s1c1
Sequence:CCGGCCCTACATGGACCAATGCAAACTCGAGTTTGCATTGGTCCATGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-3100s1c1
Sequence:CCGGGCCCGAAATCTGGATCTCAAACTCGAGTTTGAGATCCAGATTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-3762s1c1
Sequence:CCGGCCCGGCAGGAAACTTTGATAACTCGAGTTATCAAAGTTTCCTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020253.2-4930s1c1
Sequence:CCGGCGTTCGTTTATTTCCCTCGATCTCGAGATCGAGGGAAATAAACGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020253
NRXN2 MISSION shRNA shRNA Plasmid DNA
neurexin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-1753s1c1
Sequence:CCGGCGCAAGGTCAATGATGGTGAACTCGAGTTCACCATCATTGACCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-2683s1c1
Sequence:CCGGCCCTACATGGACCAATGCAAACTCGAGTTTGCATTGGTCCATGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-3100s1c1
Sequence:CCGGGCCCGAAATCTGGATCTCAAACTCGAGTTTGAGATCCAGATTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-3762s1c1
Sequence:CCGGCCCGGCAGGAAACTTTGATAACTCGAGTTATCAAAGTTTCCTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020253.2-4930s1c1
Sequence:CCGGCGTTCGTTTATTTCCCTCGATCTCGAGATCGAGGGAAATAAACGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020253
NRXN2 MISSION shRNA Lentiviral Transduction Particles
neurexin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-1753s1c1
Sequence:CCGGCGCAAGGTCAATGATGGTGAACTCGAGTTCACCATCATTGACCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-2683s1c1
Sequence:CCGGCCCTACATGGACCAATGCAAACTCGAGTTTGCATTGGTCCATGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-3100s1c1
Sequence:CCGGGCCCGAAATCTGGATCTCAAACTCGAGTTTGAGATCCAGATTTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020253.2-3762s1c1
Sequence:CCGGCCCGGCAGGAAACTTTGATAACTCGAGTTATCAAAGTTTCCTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020253.2-4930s1c1
Sequence:CCGGCGTTCGTTTATTTCCCTCGATCTCGAGATCGAGGGAAATAAACGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)