EMAIL THIS PAGE TO A FRIEND

NRXN3

neurexin 3

457 Gene Product Result for
Synonyms: C14orf60
Gene ID:
Human(9369) Summary: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants and protein isoforms for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. Genetic variation at this locus has been associated with a range of behavioral phenotypes, including alcohol dependence and autism spectrum disorder. [provided by RefSeq, Dec 2012]
Mouse(18191) neurexin III
Rat(116508) neurexin 3
chicken(423385) neurexin 3
dog(490812) neurexin 3
cow(614412) neurexin 3
sheep(101116577) neurexin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004796 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105250 Rosetta Predictions human pricing
NM_004796 Rosetta Predictions human pricing
NM_138970 Rosetta Predictions human pricing
NM_053817 Rosetta Predictions rat pricing
NM_172544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324084 predicted 1628
2 SASI_Hs02_00324085 predicted 2343
3 SASI_Hs02_00324086 predicted 1438
4 SASI_Hs02_00324087 predicted 1555
5 SASI_Hs02_00324088 predicted 2340
6 SASI_Hs02_00324089 predicted 1907
7 SASI_Hs02_00324090 predicted 1587
8 SASI_Hs02_00324091 predicted 2436
9 SASI_Hs02_00324092 predicted 1264
10 SASI_Hs02_00324093 predicted 1695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115113 predicted 1426
2 SASI_Hs01_00115109 predicted 2987
3 SASI_Hs01_00115114 predicted 1730
4 SASI_Hs01_00115116 predicted 1419
5 SASI_Hs01_00115110 predicted 3013
6 SASI_Hs02_00338324 predicted 2424
7 SASI_Hs02_00338325 predicted 1486
8 SASI_Hs02_00338326 predicted 3725
9 SASI_Hs02_00338327 predicted 3683
10 SASI_Hs02_00338328 predicted 1742
11 SASI_Hs01_00115108 predicted 2852
12 SASI_Hs01_00115111 predicted 2965
13 SASI_Hs01_00115112 predicted 2970
14 SASI_Hs01_00115115 predicted 2295
15 SASI_Hs01_00115117 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038696 predicted 2260
2 SASI_Hs01_00038693 predicted 1441
3 SASI_Hs01_00038694 predicted 1582
4 SASI_Hs01_00038698 predicted 2257
5 SASI_Hs01_00038699 predicted 1814
6 SASI_Hs01_00038700 predicted 2357
7 SASI_Hs01_00038701 predicted 1263
8 SASI_Hs01_00038695 predicted 1613
9 SASI_Hs01_00038702 predicted 2330
10 SASI_Hs02_00364020 predicted 2285
11 SASI_Hs01_00038697 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266643 predicted 2140
2 SASI_Rn01_00052798 predicted 766
3 SASI_Rn02_00266644 predicted 5480
4 SASI_Rn02_00266645 predicted 1508
5 SASI_Rn01_00052799 predicted 1557
6 SASI_Rn02_00266646 predicted 3436
7 SASI_Rn01_00052800 predicted 1279
8 SASI_Rn01_00052801 predicted 4623
9 SASI_Rn01_00052802 predicted 2891
10 SASI_Rn02_00266647 predicted 1898
11 SASI_Rn01_00052803 predicted 4882
12 SASI_Rn01_00052804 predicted 2823
13 SASI_Rn01_00052805 predicted 2621
14 SASI_Rn01_00052806 predicted 4395
15 SASI_Rn01_00052807 predicted 2228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114980 predicted 2979
2 SASI_Mm01_00114981 predicted 928
3 SASI_Mm01_00114982 predicted 3192
4 SASI_Mm01_00114983 predicted 2851
5 SASI_Mm01_00114985 predicted 692
6 SASI_Mm01_00114986 predicted 3448
7 SASI_Mm01_00114987 predicted 1609
8 SASI_Mm01_00114989 predicted 3098
9 SASI_Mm02_00344153 predicted 1817
10 SASI_Mm02_00344154 predicted 3595
11 SASI_Mm01_00114984 predicted 1625
12 SASI_Mm01_00114988 predicted 1809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172544
NRXN3 MISSION shRNA Bacterial Glycerol Stock
neurexin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172544.1-4351s1c1
Sequence:CCGGGCTCCAAGTGAGTCTGTAATACTCGAGTATTACAGACTCACTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-3606s1c1
Sequence:CCGGCCACGTCAGATGATCTTGTTTCTCGAGAAACAAGATCATCTGACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-3605s1c1
Sequence:CCGGCCCACGTCAGATGATCTTGTTCTCGAGAACAAGATCATCTGACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-2062s1c1
Sequence:CCGGCCATCTACAGAGCCTCATGTTCTCGAGAACATGAGGCTCTGTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-3385s1c1
Sequence:CCGGGCTCTATTATGATGGTTTGAACTCGAGTTCAAACCATCATAATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172544
NRXN3 MISSION shRNA shRNA Plasmid DNA
neurexin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172544.1-4351s1c1
Sequence:CCGGGCTCCAAGTGAGTCTGTAATACTCGAGTATTACAGACTCACTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-3606s1c1
Sequence:CCGGCCACGTCAGATGATCTTGTTTCTCGAGAAACAAGATCATCTGACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-3605s1c1
Sequence:CCGGCCCACGTCAGATGATCTTGTTCTCGAGAACAAGATCATCTGACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-2062s1c1
Sequence:CCGGCCATCTACAGAGCCTCATGTTCTCGAGAACATGAGGCTCTGTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-3385s1c1
Sequence:CCGGGCTCTATTATGATGGTTTGAACTCGAGTTCAAACCATCATAATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172544
NRXN3 MISSION shRNA Lentiviral Transduction Particles
neurexin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172544.1-4351s1c1
Sequence:CCGGGCTCCAAGTGAGTCTGTAATACTCGAGTATTACAGACTCACTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-3606s1c1
Sequence:CCGGCCACGTCAGATGATCTTGTTTCTCGAGAAACAAGATCATCTGACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-3605s1c1
Sequence:CCGGCCCACGTCAGATGATCTTGTTCTCGAGAACAAGATCATCTGACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-2062s1c1
Sequence:CCGGCCATCTACAGAGCCTCATGTTCTCGAGAACATGAGGCTCTGTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172544.1-3385s1c1
Sequence:CCGGGCTCTATTATGATGGTTTGAACTCGAGTTCAAACCATCATAATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004796
NRXN3 MISSION shRNA Bacterial Glycerol Stock
neurexin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004796.3-4512s1c1
Sequence:CCGGCCCAGGATCTAATTTCAGAATCTCGAGATTCTGAAATTAGATCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-2531s1c1
Sequence:CCGGCCAGGAAGATTCATGTGCCAACTCGAGTTGGCACATGAATCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-1791s1c1
Sequence:CCGGCGTTTGGAGTTCCACAACATTCTCGAGAATGTTGTGGAACTCCAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-580s1c1
Sequence:CCGGGCTGCCTTAAAGAGGTTGTTTCTCGAGAAACAACCTCTTTAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-2253s1c1
Sequence:CCGGCGGGACAATAGTAACACTCATCTCGAGATGAGTGTTACTATTGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004796
NRXN3 MISSION shRNA shRNA Plasmid DNA
neurexin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004796.3-4512s1c1
Sequence:CCGGCCCAGGATCTAATTTCAGAATCTCGAGATTCTGAAATTAGATCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-2531s1c1
Sequence:CCGGCCAGGAAGATTCATGTGCCAACTCGAGTTGGCACATGAATCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-1791s1c1
Sequence:CCGGCGTTTGGAGTTCCACAACATTCTCGAGAATGTTGTGGAACTCCAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-580s1c1
Sequence:CCGGGCTGCCTTAAAGAGGTTGTTTCTCGAGAAACAACCTCTTTAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-2253s1c1
Sequence:CCGGCGGGACAATAGTAACACTCATCTCGAGATGAGTGTTACTATTGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004796
NRXN3 MISSION shRNA Lentiviral Transduction Particles
neurexin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004796.3-4512s1c1
Sequence:CCGGCCCAGGATCTAATTTCAGAATCTCGAGATTCTGAAATTAGATCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-2531s1c1
Sequence:CCGGCCAGGAAGATTCATGTGCCAACTCGAGTTGGCACATGAATCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-1791s1c1
Sequence:CCGGCGTTTGGAGTTCCACAACATTCTCGAGAATGTTGTGGAACTCCAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-580s1c1
Sequence:CCGGGCTGCCTTAAAGAGGTTGTTTCTCGAGAAACAACCTCTTTAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004796.3-2253s1c1
Sequence:CCGGCGGGACAATAGTAACACTCATCTCGAGATGAGTGTTACTATTGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)