EMAIL THIS PAGE TO A FRIEND

NSG1

107 Gene Product Result for
Synonyms: D4S234 D4S234E NEEP21 P21
UniProtKB ID: P42857, Q49AQ1
Gene ID:
Mouse(18196) neuron specific gene family member 1
Rat(25247) neuron specific gene family member 1
chicken(395251) neuron specific gene family member 1
cow(523110) neuron specific gene family member 1
dog(479096) neuron specific gene family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014392 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090501 MISSION® esiRNA esiRNA targeting mouse Nsg1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040101 Rosetta Predictions human pricing
NM_014392 Rosetta Predictions human pricing
NM_024128 Rosetta Predictions rat pricing
NM_010942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010393 predicted 1262
2 SASI_Hs01_00010394 predicted 1215
3 SASI_Hs01_00010396 predicted 1069
4 SASI_Hs02_00308821 predicted 1153
5 SASI_Hs01_00010397 predicted 1096
6 SASI_Hs01_00010398 predicted 1164
7 SASI_Hs01_00010399 predicted 1082
8 SASI_Hs01_00010400 predicted 651
9 SASI_Hs01_00010401 predicted 610
10 SASI_Hs01_00010402 predicted 1013
11 SASI_Hs01_00010395 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166496 predicted 1789
2 SASI_Hs01_00166497 predicted 1740
3 SASI_Hs01_00166499 predicted 1601
4 SASI_Hs02_00345574 predicted 1678
5 SASI_Hs01_00166500 predicted 1620
6 SASI_Hs01_00166501 predicted 1699
7 SASI_Hs01_00166502 predicted 1612
8 SASI_Hs01_00166503 predicted 1176
9 SASI_Hs01_00166504 predicted 1141
10 SASI_Hs01_00166505 predicted 1547
11 SASI_Hs01_00166498 predicted 1764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033691 predicted 709
2 SASI_Rn01_00033692 predicted 292
3 SASI_Rn01_00033694 predicted 353
4 SASI_Rn01_00033695 predicted 415
5 SASI_Rn01_00033696 predicted 648
6 SASI_Rn01_00033697 predicted 956
7 SASI_Rn01_00033698 predicted 1114
8 SASI_Rn01_00033699 predicted 1079
9 SASI_Rn01_00033700 predicted 1044
10 SASI_Rn02_00263848 predicted 256
11 SASI_Rn01_00033693 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160348 predicted 787
2 SASI_Mm01_00160349 predicted 732
3 SASI_Mm01_00160350 predicted 751
4 SASI_Mm01_00160351 predicted 712
5 SASI_Mm01_00160352 predicted 484
6 SASI_Mm01_00160353 predicted 672
7 SASI_Mm01_00160355 predicted 911
8 SASI_Mm01_00160356 predicted 304
9 SASI_Mm01_00160357 predicted 725
10 SASI_Mm02_00319699 predicted 536
11 SASI_Mm01_00160354 predicted 1032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010942
VALIDATED
NSG1 MISSION shRNA Bacterial Glycerol Stock
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-1033s21c1
Sequence:CCGGGACCTTACTCCATAGCCATATCTCGAGATATGGCTATGGAGTAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-439s21c1
Sequence:CCGGCCCTGATGGGTTTGTCTTGAACTCGAGTTCAAGACAAACCCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-400s21c1
Sequence:CCGGCCTGGTTGTCTACAAAGTGTACTCGAGTACACTTTGTAGACAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010942.2-425s1c1
Sequence:CCGGCCCTGATGGGTTTGTCTTGAACTCGAGTTCAAGACAAACCCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010942.2-152s1c1
Sequence:CCGGCTTCGACACCATTCCTTTGATCTCGAGATCAAAGGAATGGTGTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010942.2-1728s1c1
Sequence:CCGGCGTCCTTTAGTAGGTCAGAAACTCGAGTTTCTGACCTACTAAAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-159s21c1
Sequence:CCGGAGGATGGCTTCGACACCATTCCTCGAGGAATGGTGTCGAAGCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010942.2-210s1c1
Sequence:CCGGCCAGATAAGGTCGTGGTGAAACTCGAGTTTCACCACGACCTTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010942.2-386s1c1
Sequence:CCGGCCTGGTTGTCTACAAAGTGTACTCGAGTACACTTTGTAGACAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-328s21c1
Sequence:CCGGGGGTGTCACCGAGAGGTTTAACTCGAGTTAAACCTCTCGGTGACACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010942
VALIDATED
NSG1 MISSION shRNA shRNA Plasmid DNA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-1033s21c1
Sequence:CCGGGACCTTACTCCATAGCCATATCTCGAGATATGGCTATGGAGTAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-439s21c1
Sequence:CCGGCCCTGATGGGTTTGTCTTGAACTCGAGTTCAAGACAAACCCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-400s21c1
Sequence:CCGGCCTGGTTGTCTACAAAGTGTACTCGAGTACACTTTGTAGACAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010942.2-425s1c1
Sequence:CCGGCCCTGATGGGTTTGTCTTGAACTCGAGTTCAAGACAAACCCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010942.2-152s1c1
Sequence:CCGGCTTCGACACCATTCCTTTGATCTCGAGATCAAAGGAATGGTGTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010942.2-1728s1c1
Sequence:CCGGCGTCCTTTAGTAGGTCAGAAACTCGAGTTTCTGACCTACTAAAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-159s21c1
Sequence:CCGGAGGATGGCTTCGACACCATTCCTCGAGGAATGGTGTCGAAGCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010942.2-210s1c1
Sequence:CCGGCCAGATAAGGTCGTGGTGAAACTCGAGTTTCACCACGACCTTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010942.2-386s1c1
Sequence:CCGGCCTGGTTGTCTACAAAGTGTACTCGAGTACACTTTGTAGACAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-328s21c1
Sequence:CCGGGGGTGTCACCGAGAGGTTTAACTCGAGTTAAACCTCTCGGTGACACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010942
VALIDATED
NSG1 MISSION shRNA Lentiviral Transduction Particles
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-1033s21c1
Sequence:CCGGGACCTTACTCCATAGCCATATCTCGAGATATGGCTATGGAGTAAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-439s21c1
Sequence:CCGGCCCTGATGGGTTTGTCTTGAACTCGAGTTCAAGACAAACCCATCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-400s21c1
Sequence:CCGGCCTGGTTGTCTACAAAGTGTACTCGAGTACACTTTGTAGACAACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010942.2-425s1c1
Sequence:CCGGCCCTGATGGGTTTGTCTTGAACTCGAGTTCAAGACAAACCCATCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010942.2-152s1c1
Sequence:CCGGCTTCGACACCATTCCTTTGATCTCGAGATCAAAGGAATGGTGTCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010942.2-1728s1c1
Sequence:CCGGCGTCCTTTAGTAGGTCAGAAACTCGAGTTTCTGACCTACTAAAGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-159s21c1
Sequence:CCGGAGGATGGCTTCGACACCATTCCTCGAGGAATGGTGTCGAAGCCATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010942.2-210s1c1
Sequence:CCGGCCAGATAAGGTCGTGGTGAAACTCGAGTTTCACCACGACCTTATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010942.2-386s1c1
Sequence:CCGGCCTGGTTGTCTACAAAGTGTACTCGAGTACACTTTGTAGACAACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010942.3-328s21c1
Sequence:CCGGGGGTGTCACCGAGAGGTTTAACTCGAGTTAAACCTCTCGGTGACACCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014392
VALIDATED
NSG1 MISSION shRNA Bacterial Glycerol Stock
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-469s1c1
Sequence:CCGGCTTCCTGGTTGTCTACAAGGTCTCGAGACCTTGTAGACAACCAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_014392.2-472s1c1
Sequence:CCGGCCTGGTTGTCTACAAGGTGTACTCGAGTACACCTTGTAGACAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014392.2-977s1c1
Sequence:CCGGGCTCCTTTACTGGGATTTATTCTCGAGAATAAATCCCAGTAAAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-1033s1c1
Sequence:CCGGCGAAGGGTTTGGATCTCAGATCTCGAGATCTGAGATCCAAACCCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-268s1c1
Sequence:CCGGCGATGTCAATCAGCTGCAGTTCTCGAGAACTGCAGCTGATTGACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-412s1c1
Sequence:CCGGGAGGTTTAAGGTCTCCGTGTTCTCGAGAACACGGAGACCTTAAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014392.2-1321s1c1
Sequence:CCGGGAGCAATAAATCAGTGCCAAACTCGAGTTTGGCACTGATTTATTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-479s1c1
Sequence:CCGGGTCTACAAGGTGTACAAGTATCTCGAGATACTTGTACACCTTGTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-670s1c1
Sequence:CCGGGTCAGTTCTGTCAGAAGAGAACTCGAGTTCTCTTCTGACAGAACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-607s1c1
Sequence:CCGGCACAGTCATAAACCACTACAACTCGAGTTGTAGTGGTTTATGACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014392.2-415s1c1
Sequence:CCGGGTTTAAGGTCTCCGTGTTGGTCTCGAGACCAACACGGAGACCTTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014392
VALIDATED
NSG1 MISSION shRNA shRNA Plasmid DNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-469s1c1
Sequence:CCGGCTTCCTGGTTGTCTACAAGGTCTCGAGACCTTGTAGACAACCAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_014392.2-472s1c1
Sequence:CCGGCCTGGTTGTCTACAAGGTGTACTCGAGTACACCTTGTAGACAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014392.2-977s1c1
Sequence:CCGGGCTCCTTTACTGGGATTTATTCTCGAGAATAAATCCCAGTAAAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-1033s1c1
Sequence:CCGGCGAAGGGTTTGGATCTCAGATCTCGAGATCTGAGATCCAAACCCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-268s1c1
Sequence:CCGGCGATGTCAATCAGCTGCAGTTCTCGAGAACTGCAGCTGATTGACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-412s1c1
Sequence:CCGGGAGGTTTAAGGTCTCCGTGTTCTCGAGAACACGGAGACCTTAAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014392.2-1321s1c1
Sequence:CCGGGAGCAATAAATCAGTGCCAAACTCGAGTTTGGCACTGATTTATTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-479s1c1
Sequence:CCGGGTCTACAAGGTGTACAAGTATCTCGAGATACTTGTACACCTTGTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-670s1c1
Sequence:CCGGGTCAGTTCTGTCAGAAGAGAACTCGAGTTCTCTTCTGACAGAACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-607s1c1
Sequence:CCGGCACAGTCATAAACCACTACAACTCGAGTTGTAGTGGTTTATGACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014392.2-415s1c1
Sequence:CCGGGTTTAAGGTCTCCGTGTTGGTCTCGAGACCAACACGGAGACCTTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014392
VALIDATED
NSG1 MISSION shRNA Lentiviral Transduction Particles
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-469s1c1
Sequence:CCGGCTTCCTGGTTGTCTACAAGGTCTCGAGACCTTGTAGACAACCAGGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_014392.2-472s1c1
Sequence:CCGGCCTGGTTGTCTACAAGGTGTACTCGAGTACACCTTGTAGACAACCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014392.2-977s1c1
Sequence:CCGGGCTCCTTTACTGGGATTTATTCTCGAGAATAAATCCCAGTAAAGGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-1033s1c1
Sequence:CCGGCGAAGGGTTTGGATCTCAGATCTCGAGATCTGAGATCCAAACCCTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-268s1c1
Sequence:CCGGCGATGTCAATCAGCTGCAGTTCTCGAGAACTGCAGCTGATTGACATCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-412s1c1
Sequence:CCGGGAGGTTTAAGGTCTCCGTGTTCTCGAGAACACGGAGACCTTAAACCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014392.2-1321s1c1
Sequence:CCGGGAGCAATAAATCAGTGCCAAACTCGAGTTTGGCACTGATTTATTGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-479s1c1
Sequence:CCGGGTCTACAAGGTGTACAAGTATCTCGAGATACTTGTACACCTTGTAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-670s1c1
Sequence:CCGGGTCAGTTCTGTCAGAAGAGAACTCGAGTTCTCTTCTGACAGAACTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014392.2-607s1c1
Sequence:CCGGCACAGTCATAAACCACTACAACTCGAGTTGTAGTGGTTTATGACTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014392.2-415s1c1
Sequence:CCGGGTTTAAGGTCTCCGTGTTGGTCTCGAGACCAACACGGAGACCTTAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)