EMAIL THIS PAGE TO A FRIEND

NSL1

NSL1, MIS12 kinetochore complex component

266 Gene Product Result for
Synonyms: C1orf48 MIS14
UniProtKB ID: Q96IY1, E7ETD5, Q5SY75, Q9H2M5, Q9NRN8, Q9Y415
Gene ID:
Human(25936) Summary: This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(381318) NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
Rat(498310) NSL1, MIS12 kinetochore complex component
sheep(101115297) NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
domestic guinea pig(100721544) NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
Thale Cress(839735) MAC/Perforin domain-containing protein
Zebrafish(562522) NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
cow(506867) NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
Horse(100050694) NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
domestic cat(101082714) NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
dog(480025) NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
chicken(421367) NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015471 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042549 Rosetta Predictions human pricing
NM_015471 Rosetta Predictions human pricing
NM_001109083 Rosetta Predictions rat pricing
NM_198654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310518 predicted 1012
2 SASI_Hs02_00310519 predicted 418
3 SASI_Hs02_00310520 predicted 806
4 SASI_Hs02_00310521 predicted 386
5 SASI_Hs02_00310522 predicted 814
6 SASI_Hs02_00310523 predicted 791
7 SASI_Hs02_00310524 predicted 1022
8 SASI_Hs02_00310525 predicted 1010
9 SASI_Hs02_00310526 predicted 832
10 SASI_Hs02_00310527 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173960 predicted 933
2 SASI_Hs01_00173957 predicted 425
3 SASI_Hs01_00173958 predicted 720
4 SASI_Hs01_00173961 predicted 381
5 SASI_Hs02_00347900 predicted 725
6 SASI_Hs01_00173962 predicted 487
7 SASI_Hs01_00173963 predicted 698
8 SASI_Hs01_00173964 predicted 930
9 SASI_Hs01_00173965 predicted 922
10 SASI_Hs02_00347901 predicted 739
11 SASI_Hs01_00173956 predicted 858
12 SASI_Hs01_00173959 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244960 predicted 1358
2 SASI_Rn02_00244961 predicted 371
3 SASI_Rn02_00244962 predicted 679
4 SASI_Rn02_00244963 predicted 1269
5 SASI_Rn02_00244964 predicted 857
6 SASI_Rn02_00244965 predicted 928
7 SASI_Rn02_00244966 predicted 443
8 SASI_Rn02_00244967 predicted 717
9 SASI_Rn02_00244968 predicted 584
10 SASI_Rn02_00244969 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173593 predicted 840
2 SASI_Mm02_00351121 predicted 854
3 SASI_Mm01_00173594 predicted 333
4 SASI_Mm01_00173595 predicted 650
5 SASI_Mm01_00173596 predicted 450
6 SASI_Mm01_00173597 predicted 693
7 SASI_Mm01_00173598 predicted 700
8 SASI_Mm01_00173599 predicted 866
9 SASI_Mm01_00173600 predicted 761
10 SASI_Mm01_00173601 predicted 305
11 SASI_Mm01_00173602 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198654
NSL1 MISSION shRNA Bacterial Glycerol Stock
NSL1, MIS12 kinetochore complex component
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198654.1-344s1c1
Sequence:CCGGGTGCTTGAAGATGAATTTGATCTCGAGATCAAATTCATCTTCAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198654.1-268s1c1
Sequence:CCGGGCAGGAGAACGTCAGCTTTAACTCGAGTTAAAGCTGACGTTCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-832s21c1
Sequence:CCGGCTGCGGCTGCAGAGAATTAATCTCGAGATTAATTCTCTGCAGCCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-854s21c1
Sequence:CCGGTCGATATGTGAGCTCTGTTTGCTCGAGCAAACAGAGCTCACATATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198654.2-507s1c1
Sequence:CCGGGCTTCTCGTGTAGAAGATTTGCTCGAGCAAATCTTCTACACGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-309s21c1
Sequence:CCGGAGCTAAAGAGCATGGCTTAATCTCGAGATTAAGCCATGCTCTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-452s21c1
Sequence:CCGGACGCGAGTCTGAAGCAGTATCCTCGAGGATACTGCTTCAGACTCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198654.3-1860s21c1
Sequence:CCGGCGCCGAACTTGCCATCTATTTCTCGAGAAATAGATGGCAAGTTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198654
NSL1 MISSION shRNA shRNA Plasmid DNA
NSL1, MIS12 kinetochore complex component
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198654.1-344s1c1
Sequence:CCGGGTGCTTGAAGATGAATTTGATCTCGAGATCAAATTCATCTTCAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198654.1-268s1c1
Sequence:CCGGGCAGGAGAACGTCAGCTTTAACTCGAGTTAAAGCTGACGTTCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-832s21c1
Sequence:CCGGCTGCGGCTGCAGAGAATTAATCTCGAGATTAATTCTCTGCAGCCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-854s21c1
Sequence:CCGGTCGATATGTGAGCTCTGTTTGCTCGAGCAAACAGAGCTCACATATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198654.2-507s1c1
Sequence:CCGGGCTTCTCGTGTAGAAGATTTGCTCGAGCAAATCTTCTACACGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-309s21c1
Sequence:CCGGAGCTAAAGAGCATGGCTTAATCTCGAGATTAAGCCATGCTCTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-452s21c1
Sequence:CCGGACGCGAGTCTGAAGCAGTATCCTCGAGGATACTGCTTCAGACTCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198654.3-1860s21c1
Sequence:CCGGCGCCGAACTTGCCATCTATTTCTCGAGAAATAGATGGCAAGTTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198654
NSL1 MISSION shRNA Lentiviral Transduction Particles
NSL1, MIS12 kinetochore complex component
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198654.1-344s1c1
Sequence:CCGGGTGCTTGAAGATGAATTTGATCTCGAGATCAAATTCATCTTCAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198654.1-268s1c1
Sequence:CCGGGCAGGAGAACGTCAGCTTTAACTCGAGTTAAAGCTGACGTTCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-832s21c1
Sequence:CCGGCTGCGGCTGCAGAGAATTAATCTCGAGATTAATTCTCTGCAGCCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-854s21c1
Sequence:CCGGTCGATATGTGAGCTCTGTTTGCTCGAGCAAACAGAGCTCACATATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198654.2-507s1c1
Sequence:CCGGGCTTCTCGTGTAGAAGATTTGCTCGAGCAAATCTTCTACACGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-309s21c1
Sequence:CCGGAGCTAAAGAGCATGGCTTAATCTCGAGATTAAGCCATGCTCTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198654.3-452s21c1
Sequence:CCGGACGCGAGTCTGAAGCAGTATCCTCGAGGATACTGCTTCAGACTCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198654.3-1860s21c1
Sequence:CCGGCGCCGAACTTGCCATCTATTTCTCGAGAAATAGATGGCAAGTTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015471
NSL1 MISSION shRNA Bacterial Glycerol Stock
NSL1, MIS12 kinetochore complex component
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015471.2-401s1c1
Sequence:CCGGGCAGTATCCCAGAAAGATCCTCTCGAGAGGATCTTTCTGGGATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015471.2-153s1c1
Sequence:CCGGGCTGTGACCGAAATGCTACAACTCGAGTTGTAGCATTTCGGTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015471.2-1367s1c1
Sequence:CCGGGCTGATGATAATACTGGCTTTCTCGAGAAAGCCAGTATTATCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015471.2-270s1c1
Sequence:CCGGGTGCAAGAGAATATCAGCATTCTCGAGAATGCTGATATTCTCTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015471.2-1383s1c1
Sequence:CCGGGCTTTGACTTTGTTACTCCATCTCGAGATGGAGTAACAAAGTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015471.2-480s1c1
Sequence:CCGGGTTGTACATCCACTGGACCTACTCGAGTAGGTCCAGTGGATGTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015471.2-581s1c1
Sequence:CCGGCATGAAGTCCTTGCCTGCATTCTCGAGAATGCAGGCAAGGACTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015471.3-167s21c1
Sequence:CCGGGCTGTGACCGAAATGCTACAACTCGAGTTGTAGCATTTCGGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015471.3-1397s21c1
Sequence:CCGGGCTTTGACTTTGTTACTCCATCTCGAGATGGAGTAACAAAGTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015471.3-595s21c1
Sequence:CCGGCATGAAGTCCTTGCCTGCATTCTCGAGAATGCAGGCAAGGACTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015471.3-1381s21c1
Sequence:CCGGGCTGATGATAATACTGGCTTTCTCGAGAAAGCCAGTATTATCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015471
NSL1 MISSION shRNA shRNA Plasmid DNA
NSL1, MIS12 kinetochore complex component
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015471.2-401s1c1
Sequence:CCGGGCAGTATCCCAGAAAGATCCTCTCGAGAGGATCTTTCTGGGATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015471.2-153s1c1
Sequence:CCGGGCTGTGACCGAAATGCTACAACTCGAGTTGTAGCATTTCGGTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015471.2-1367s1c1
Sequence:CCGGGCTGATGATAATACTGGCTTTCTCGAGAAAGCCAGTATTATCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015471.2-270s1c1
Sequence:CCGGGTGCAAGAGAATATCAGCATTCTCGAGAATGCTGATATTCTCTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015471.2-1383s1c1
Sequence:CCGGGCTTTGACTTTGTTACTCCATCTCGAGATGGAGTAACAAAGTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015471.2-480s1c1
Sequence:CCGGGTTGTACATCCACTGGACCTACTCGAGTAGGTCCAGTGGATGTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015471.2-581s1c1
Sequence:CCGGCATGAAGTCCTTGCCTGCATTCTCGAGAATGCAGGCAAGGACTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015471.3-167s21c1
Sequence:CCGGGCTGTGACCGAAATGCTACAACTCGAGTTGTAGCATTTCGGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015471.3-1397s21c1
Sequence:CCGGGCTTTGACTTTGTTACTCCATCTCGAGATGGAGTAACAAAGTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015471.3-595s21c1
Sequence:CCGGCATGAAGTCCTTGCCTGCATTCTCGAGAATGCAGGCAAGGACTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015471.3-1381s21c1
Sequence:CCGGGCTGATGATAATACTGGCTTTCTCGAGAAAGCCAGTATTATCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015471
NSL1 MISSION shRNA Lentiviral Transduction Particles
NSL1, MIS12 kinetochore complex component
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015471.2-401s1c1
Sequence:CCGGGCAGTATCCCAGAAAGATCCTCTCGAGAGGATCTTTCTGGGATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015471.2-153s1c1
Sequence:CCGGGCTGTGACCGAAATGCTACAACTCGAGTTGTAGCATTTCGGTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015471.2-1367s1c1
Sequence:CCGGGCTGATGATAATACTGGCTTTCTCGAGAAAGCCAGTATTATCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015471.2-270s1c1
Sequence:CCGGGTGCAAGAGAATATCAGCATTCTCGAGAATGCTGATATTCTCTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015471.2-1383s1c1
Sequence:CCGGGCTTTGACTTTGTTACTCCATCTCGAGATGGAGTAACAAAGTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015471.2-480s1c1
Sequence:CCGGGTTGTACATCCACTGGACCTACTCGAGTAGGTCCAGTGGATGTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015471.2-581s1c1
Sequence:CCGGCATGAAGTCCTTGCCTGCATTCTCGAGAATGCAGGCAAGGACTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015471.3-167s21c1
Sequence:CCGGGCTGTGACCGAAATGCTACAACTCGAGTTGTAGCATTTCGGTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015471.3-1397s21c1
Sequence:CCGGGCTTTGACTTTGTTACTCCATCTCGAGATGGAGTAACAAAGTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015471.3-595s21c1
Sequence:CCGGCATGAAGTCCTTGCCTGCATTCTCGAGAATGCAGGCAAGGACTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015471.3-1381s21c1
Sequence:CCGGGCTGATGATAATACTGGCTTTCTCGAGAAAGCCAGTATTATCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)