EMAIL THIS PAGE TO A FRIEND

NSMAF

neutral sphingomyelinase (N-SMase) activation associated factor

71 Gene Product Result for
Synonyms: FAN
UniProtKB ID: Q92636, B4DFB0, E9PCH0, Q8IW26
Gene ID:
Human(8439) Summary: This gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor. This protein is required for TNF-mediated activation of neutral sphingomyelinase and may play a role in regulating TNF-induced cellular responses such as inflammation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
Mouse(18201) neutral sphingomyelinase (N-SMase) activation associated factor
Rat(353233) neutral sphingomyelinase (N-SMase) activation associated factor
Zebrafish(550506) neutral sphingomyelinase (N-SMase) activation associated factor
cow(509626) neutral sphingomyelinase (N-SMase) activation associated factor
domestic cat(101082717) neutral sphingomyelinase (N-SMase) activation associated factor
dog(477892) neutral sphingomyelinase (N-SMase) activation associated factor
chicken(421137) neutral sphingomyelinase (N-SMase) activation associated factor
domestic guinea pig(100728496) neutral sphingomyelinase (N-SMase) activation associated factor
naked mole-rat(101706704) neutral sphingomyelinase (N-SMase) activation associated factor
sheep(101110070) neutral sphingomyelinase (N-SMase) activation associated factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003580 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003580 Rosetta Predictions human pricing
NM_181389 Rosetta Predictions rat pricing
NM_010945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049065 predicted 290
2 SASI_Hs01_00049066 predicted 685
3 SASI_Hs01_00049067 predicted 1546
4 SASI_Hs01_00049068 predicted 1598
5 SASI_Hs01_00049069 predicted 1011
6 SASI_Hs01_00049070 predicted 1225
7 SASI_Hs01_00049071 predicted 2085
8 SASI_Hs01_00049073 predicted 3023
9 SASI_Hs01_00049074 predicted 966
10 SASI_Hs02_00335894 predicted 1802
11 SASI_Hs01_00049072 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269737 predicted 2381
2 SASI_Rn01_00062562 predicted 2075
3 SASI_Rn01_00062564 predicted 1308
4 SASI_Rn01_00062565 predicted 2090
5 SASI_Rn01_00062566 predicted 1319
6 SASI_Rn01_00062567 predicted 324
7 SASI_Rn01_00062568 predicted 676
8 SASI_Rn01_00062569 predicted 1959
9 SASI_Rn01_00062570 predicted 716
10 SASI_Rn01_00062571 predicted 2165
11 SASI_Rn01_00062563 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103941 predicted 2911
2 SASI_Mm02_00319702 predicted 1447
3 SASI_Mm01_00103942 predicted 2526
4 SASI_Mm01_00103943 predicted 2610
5 SASI_Mm01_00103946 predicted 1398
6 SASI_Mm01_00103944 predicted 1316
7 SASI_Mm01_00103947 predicted 2495
8 SASI_Mm01_00103948 predicted 2805
9 SASI_Mm01_00103949 predicted 2063
10 SASI_Mm01_00103950 predicted 1527
11 SASI_Mm01_00103945 predicted 2308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010945
VALIDATED
NSMAF MISSION shRNA Bacterial Glycerol Stock
neutral sphingomyelinase (N-SMase) activation associated factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010945.2-3334s21c1
Sequence:CCGGTGACGGTAACACGGTTCTTTGCTCGAGCAAAGAACCGTGTTACCGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010945.2-3000s21c1
Sequence:CCCGTCCTCTCCATCAAGTACAATTCTCGAGAATTGTACTTGATGGAGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010945.1-2614s1c1
Sequence:CCGGCCACTTTATTACACCAGACTTCTCGAGAAGTCTGGTGTAATAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010945.1-1255s1c1
Sequence:CCGGGCCCAGAACTAGATTTGTCAACTCGAGTTGACAAATCTAGTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010945.1-1145s1c1
Sequence:CCGGGCACCTTTCCAACTACCAGTACTCGAGTACTGGTAGTTGGAAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010945.1-3033s1c1
Sequence:CCGGCCAGACTTTAAACTGGTGAATCTCGAGATTCACCAGTTTAAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010945.2-1287s21c1
Sequence:CCGGTGCAACCTTCCGAGATCTTAGCTCGAGCTAAGATCTCGGAAGGTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010945.2-582s21c1
Sequence:CCGGCAACATTGTGGCACCGTATAACTCGAGTTATACGGTGCCACAATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010945.1-382s1c1
Sequence:CCGGGCTCCTTAAAGATATGTTCAACTCGAGTTGAACATATCTTTAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010945
VALIDATED
NSMAF MISSION shRNA shRNA Plasmid DNA
neutral sphingomyelinase (N-SMase) activation associated factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010945.2-3334s21c1
Sequence:CCGGTGACGGTAACACGGTTCTTTGCTCGAGCAAAGAACCGTGTTACCGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010945.2-3000s21c1
Sequence:CCCGTCCTCTCCATCAAGTACAATTCTCGAGAATTGTACTTGATGGAGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010945.1-2614s1c1
Sequence:CCGGCCACTTTATTACACCAGACTTCTCGAGAAGTCTGGTGTAATAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010945.1-1255s1c1
Sequence:CCGGGCCCAGAACTAGATTTGTCAACTCGAGTTGACAAATCTAGTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010945.1-1145s1c1
Sequence:CCGGGCACCTTTCCAACTACCAGTACTCGAGTACTGGTAGTTGGAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010945.1-3033s1c1
Sequence:CCGGCCAGACTTTAAACTGGTGAATCTCGAGATTCACCAGTTTAAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010945.2-1287s21c1
Sequence:CCGGTGCAACCTTCCGAGATCTTAGCTCGAGCTAAGATCTCGGAAGGTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010945.2-582s21c1
Sequence:CCGGCAACATTGTGGCACCGTATAACTCGAGTTATACGGTGCCACAATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010945.1-382s1c1
Sequence:CCGGGCTCCTTAAAGATATGTTCAACTCGAGTTGAACATATCTTTAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010945
VALIDATED
NSMAF MISSION shRNA Lentiviral Transduction Particles
neutral sphingomyelinase (N-SMase) activation associated factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010945.2-3334s21c1
Sequence:CCGGTGACGGTAACACGGTTCTTTGCTCGAGCAAAGAACCGTGTTACCGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010945.2-3000s21c1
Sequence:CCCGTCCTCTCCATCAAGTACAATTCTCGAGAATTGTACTTGATGGAGAGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010945.1-2614s1c1
Sequence:CCGGCCACTTTATTACACCAGACTTCTCGAGAAGTCTGGTGTAATAAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010945.1-1255s1c1
Sequence:CCGGGCCCAGAACTAGATTTGTCAACTCGAGTTGACAAATCTAGTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010945.1-1145s1c1
Sequence:CCGGGCACCTTTCCAACTACCAGTACTCGAGTACTGGTAGTTGGAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010945.1-3033s1c1
Sequence:CCGGCCAGACTTTAAACTGGTGAATCTCGAGATTCACCAGTTTAAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010945.2-1287s21c1
Sequence:CCGGTGCAACCTTCCGAGATCTTAGCTCGAGCTAAGATCTCGGAAGGTTGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010945.2-582s21c1
Sequence:CCGGCAACATTGTGGCACCGTATAACTCGAGTTATACGGTGCCACAATGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010945.1-382s1c1
Sequence:CCGGGCTCCTTAAAGATATGTTCAACTCGAGTTGAACATATCTTTAAGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003580
VALIDATED
NSMAF MISSION shRNA Bacterial Glycerol Stock
neutral sphingomyelinase (N-SMase) activation associated factor
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003580.2-412s1c1
Sequence:CCGGGCCCATCATCAAGATTCCTTTCTCGAGAAAGGAATCTTGATGATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003580.2-3123s1c1
Sequence:CCGGGCTATTCTCTTAGGGCAGATACTCGAGTATCTGCCCTAAGAGAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003580.2-284s1c1
Sequence:CCGGGAGTACTACTTTGAACAGCATCTCGAGATGCTGTTCAAAGTAGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003580.2-3231s1c1
Sequence:CCGGGCAGAGAATAGCTAAGAGATACTCGAGTATCTCTTAGCTATTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003580.2-284s21c1
Sequence:CCGGGAGTACTACTTTGAACAGCATCTCGAGATGCTGTTCAAAGTAGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003580.2-3231s21c1
Sequence:CCGGGCAGAGAATAGCTAAGAGATACTCGAGTATCTCTTAGCTATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003580.2-412s21c1
Sequence:CCGGGCCCATCATCAAGATTCCTTTCTCGAGAAAGGAATCTTGATGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003580.2-3113s21c1
Sequence:CCGGGCCATTAGTTGCTATTCTCTTCTCGAGAAGAGAATAGCAACTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003580.2-2057s1c1
Sequence:CCGGCAGTTACACGAGCACTATAAACTCGAGTTTATAGTGCTCGTGTAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003580.2-882s1c1
Sequence:CCGGCGAAACCTGTGGTCCAGATAACTCGAGTTATCTGGACCACAGGTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003580.2-3113s1c1
Sequence:CCGGGCCATTAGTTGCTATTCTCTTCTCGAGAAGAGAATAGCAACTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003580.2-2057s21c1
Sequence:CCGGCAGTTACACGAGCACTATAAACTCGAGTTTATAGTGCTCGTGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003580
VALIDATED
NSMAF MISSION shRNA shRNA Plasmid DNA
neutral sphingomyelinase (N-SMase) activation associated factor
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003580.2-412s1c1
Sequence:CCGGGCCCATCATCAAGATTCCTTTCTCGAGAAAGGAATCTTGATGATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003580.2-3123s1c1
Sequence:CCGGGCTATTCTCTTAGGGCAGATACTCGAGTATCTGCCCTAAGAGAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003580.2-284s1c1
Sequence:CCGGGAGTACTACTTTGAACAGCATCTCGAGATGCTGTTCAAAGTAGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003580.2-3231s1c1
Sequence:CCGGGCAGAGAATAGCTAAGAGATACTCGAGTATCTCTTAGCTATTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003580.2-284s21c1
Sequence:CCGGGAGTACTACTTTGAACAGCATCTCGAGATGCTGTTCAAAGTAGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003580.2-3231s21c1
Sequence:CCGGGCAGAGAATAGCTAAGAGATACTCGAGTATCTCTTAGCTATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003580.2-412s21c1
Sequence:CCGGGCCCATCATCAAGATTCCTTTCTCGAGAAAGGAATCTTGATGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003580.2-3113s21c1
Sequence:CCGGGCCATTAGTTGCTATTCTCTTCTCGAGAAGAGAATAGCAACTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003580.2-2057s1c1
Sequence:CCGGCAGTTACACGAGCACTATAAACTCGAGTTTATAGTGCTCGTGTAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003580.2-882s1c1
Sequence:CCGGCGAAACCTGTGGTCCAGATAACTCGAGTTATCTGGACCACAGGTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003580.2-3113s1c1
Sequence:CCGGGCCATTAGTTGCTATTCTCTTCTCGAGAAGAGAATAGCAACTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003580.2-2057s21c1
Sequence:CCGGCAGTTACACGAGCACTATAAACTCGAGTTTATAGTGCTCGTGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003580
VALIDATED
NSMAF MISSION shRNA Lentiviral Transduction Particles
neutral sphingomyelinase (N-SMase) activation associated factor
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003580.2-412s1c1
Sequence:CCGGGCCCATCATCAAGATTCCTTTCTCGAGAAAGGAATCTTGATGATGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003580.2-3123s1c1
Sequence:CCGGGCTATTCTCTTAGGGCAGATACTCGAGTATCTGCCCTAAGAGAATAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003580.2-284s1c1
Sequence:CCGGGAGTACTACTTTGAACAGCATCTCGAGATGCTGTTCAAAGTAGTACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003580.2-3231s1c1
Sequence:CCGGGCAGAGAATAGCTAAGAGATACTCGAGTATCTCTTAGCTATTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003580.2-284s21c1
Sequence:CCGGGAGTACTACTTTGAACAGCATCTCGAGATGCTGTTCAAAGTAGTACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003580.2-3231s21c1
Sequence:CCGGGCAGAGAATAGCTAAGAGATACTCGAGTATCTCTTAGCTATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003580.2-412s21c1
Sequence:CCGGGCCCATCATCAAGATTCCTTTCTCGAGAAAGGAATCTTGATGATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003580.2-3113s21c1
Sequence:CCGGGCCATTAGTTGCTATTCTCTTCTCGAGAAGAGAATAGCAACTAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003580.2-2057s1c1
Sequence:CCGGCAGTTACACGAGCACTATAAACTCGAGTTTATAGTGCTCGTGTAACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003580.2-882s1c1
Sequence:CCGGCGAAACCTGTGGTCCAGATAACTCGAGTTATCTGGACCACAGGTTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003580.2-3113s1c1
Sequence:CCGGGCCATTAGTTGCTATTCTCTTCTCGAGAAGAGAATAGCAACTAATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003580.2-2057s21c1
Sequence:CCGGCAGTTACACGAGCACTATAAACTCGAGTTTATAGTGCTCGTGTAACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)