EMAIL THIS PAGE TO A FRIEND

NSMCE2

non-SMC element 2, MMS21 homolog (S. cerevisiae)

69 Gene Product Result for
Synonyms: C8orf36 MMS21 NSE2 ZMIZ7
UniProtKB ID: Q96MF7, Q8N549
Gene ID:
Mouse(68501) non-SMC element 2 homolog (MMS21, S. cerevisiae)
Rat(299957) non-SMC element 2, MMS21 homolog (S. cerevisiae)
chicken(420333) non-SMC element 2, MMS21 homolog (S. cerevisiae)
cow(519974) non-SMC element 2, MMS21 homolog (S. cerevisiae)
domestic cat(101086785) non-SMC element 2, MMS21 homolog (S. cerevisiae)
dog(475096) non-SMC element 2, MMS21 homolog (S. cerevisiae)
dog(609542) non-SMC element 2, MMS21 homolog (S. cerevisiae)
domestic guinea pig(100724833) non-SMC element 2, MMS21 homolog (S. cerevisiae)
sheep(101104408) non-SMC element 2, MMS21 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173685 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173685 Rosetta Predictions human pricing
NM_001024876 Rosetta Predictions rat pricing
NM_026746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106786 predicted 550
2 SASI_Hs01_00106788 predicted 892
3 SASI_Hs01_00106789 predicted 383
4 SASI_Hs01_00106790 predicted 467
5 SASI_Hs01_00106791 predicted 439
6 SASI_Hs01_00106792 predicted 428
7 SASI_Hs01_00106793 predicted 246
8 SASI_Hs01_00106794 predicted 381
9 SASI_Hs01_00106795 predicted 785
10 SASI_Hs02_00368630 predicted 368
11 SASI_Hs01_00106787 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048728 predicted 287
2 SASI_Rn01_00048729 predicted 266
3 SASI_Rn01_00048730 predicted 282
4 SASI_Rn01_00048731 predicted 779
5 SASI_Rn01_00048732 predicted 295
6 SASI_Rn01_00048733 predicted 268
7 SASI_Rn01_00048734 predicted 422
8 SASI_Rn02_00202760 predicted 497
9 SASI_Rn01_00048735 predicted 255
10 SASI_Rn01_00048736 predicted 424
11 SASI_Rn01_00048737 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330797 predicted 310
2 SASI_Mm01_00168145 predicted 367
3 SASI_Mm01_00168146 predicted 271
4 SASI_Mm01_00168147 predicted 333
5 SASI_Mm01_00168148 predicted 284
6 SASI_Mm01_00168150 predicted 813
7 SASI_Mm01_00168141 predicted 526
8 SASI_Mm01_00168142 predicted 535
9 SASI_Mm01_00168143 predicted 576
10 SASI_Mm02_00330798 predicted 448
11 SASI_Mm01_00168144 predicted 536
12 SASI_Mm01_00168149 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173685
VALIDATED
NSMCE2 MISSION shRNA Bacterial Glycerol Stock
non-SMC element 2, MMS21 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173685.2-412s21c1
Sequence:CCGGGACAAGGCAATGGTTGAATTTCTCGAGAAATTCAACCATTGCCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173685.1-693s1c1
Sequence:CCGGGAAGATATAATTGTGACCCAACTCGAGTTGGGTCACAATTATATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-381s1c1
Sequence:CCGGCAGACTGAAGTGAGTAGTGAACTCGAGTTCACTACTCACTTCAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173685.2-684s21c1
Sequence:CCGGAGGAGTGGATGAAGATATAATCTCGAGATTATATCTTCATCCACTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-922s1c1
Sequence:CCGGGAAGGGCAATTGAGAACCATACTCGAGTATGGTTCTCAATTGCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-441s1c1
Sequence:CCGGGATCGGCAACTAAACCATTATCTCGAGATAATGGTTTAGTTGCCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-492s1c1
Sequence:CCGGGTGAAAGAAGAACGTCCAGAACTCGAGTTCTGGACGTTCTTCTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173685.2-1020s21c1
Sequence:CCGGAGCTGTCTGTTGAGAGCAGTGCTCGAGCACTGCTCTCAACAGACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173685
VALIDATED
NSMCE2 MISSION shRNA shRNA Plasmid DNA
non-SMC element 2, MMS21 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173685.2-412s21c1
Sequence:CCGGGACAAGGCAATGGTTGAATTTCTCGAGAAATTCAACCATTGCCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173685.1-693s1c1
Sequence:CCGGGAAGATATAATTGTGACCCAACTCGAGTTGGGTCACAATTATATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-381s1c1
Sequence:CCGGCAGACTGAAGTGAGTAGTGAACTCGAGTTCACTACTCACTTCAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173685.2-684s21c1
Sequence:CCGGAGGAGTGGATGAAGATATAATCTCGAGATTATATCTTCATCCACTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-922s1c1
Sequence:CCGGGAAGGGCAATTGAGAACCATACTCGAGTATGGTTCTCAATTGCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-441s1c1
Sequence:CCGGGATCGGCAACTAAACCATTATCTCGAGATAATGGTTTAGTTGCCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-492s1c1
Sequence:CCGGGTGAAAGAAGAACGTCCAGAACTCGAGTTCTGGACGTTCTTCTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173685.2-1020s21c1
Sequence:CCGGAGCTGTCTGTTGAGAGCAGTGCTCGAGCACTGCTCTCAACAGACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173685
VALIDATED
NSMCE2 MISSION shRNA Lentiviral Transduction Particles
non-SMC element 2, MMS21 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173685.2-412s21c1
Sequence:CCGGGACAAGGCAATGGTTGAATTTCTCGAGAAATTCAACCATTGCCTTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000167618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173685.1-693s1c1
Sequence:CCGGGAAGATATAATTGTGACCCAACTCGAGTTGGGTCACAATTATATCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000168834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-381s1c1
Sequence:CCGGCAGACTGAAGTGAGTAGTGAACTCGAGTTCACTACTCACTTCAGTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173685.2-684s21c1
Sequence:CCGGAGGAGTGGATGAAGATATAATCTCGAGATTATATCTTCATCCACTCCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000168128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-922s1c1
Sequence:CCGGGAAGGGCAATTGAGAACCATACTCGAGTATGGTTCTCAATTGCCCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000167431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-441s1c1
Sequence:CCGGGATCGGCAACTAAACCATTATCTCGAGATAATGGTTTAGTTGCCGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000168516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173685.1-492s1c1
Sequence:CCGGGTGAAAGAAGAACGTCCAGAACTCGAGTTCTGGACGTTCTTCTTTCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173685.2-1020s21c1
Sequence:CCGGAGCTGTCTGTTGAGAGCAGTGCTCGAGCACTGCTCTCAACAGACAGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026746
VALIDATED
NSMCE2 MISSION shRNA Bacterial Glycerol Stock
non-SMC element 2, MMS21 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-365s21c1
Sequence:CCGGCTGTGCAGTCTACAATCAATCCTCGAGGATTGATTGTAGACTGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-576s21c1
Sequence:CCGGAGAAGGAGTTGACGAAGATATCTCGAGATATCTTCGTCAACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.1-365s1c1
Sequence:CCGGGCTGTGCAGTCTACAATCAATCTCGAGATTGATTGTAGACTGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.2-313s1c1
Sequence:CCGGGCCATGGTTGAGTTTGCTAAACTCGAGTTTAGCAAACTCAACCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-149s21c1
Sequence:CCGGCAGGTTCTACCCGTTACATATCTCGAGATATGTAACGGGTAGAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.1-529s1c1
Sequence:CCGGGCTGAAGAAGCAATATGGTATCTCGAGATACCATATTGCTTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.1-266s1c1
Sequence:CCGGCTTGTGGAGACTCAAACTGAACTCGAGTTCAGTTTGAGTCTCCACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-286s21c1
Sequence:CCGGGTGAGTAGTGAGTACAGTATGCTCGAGCATACTGTACTCACTACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-465s21c1
Sequence:CCGGGAACTCTGATGCCGACTTTAACTCGAGTTAAAGTCGGCATCAGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026746
VALIDATED
NSMCE2 MISSION shRNA shRNA Plasmid DNA
non-SMC element 2, MMS21 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-365s21c1
Sequence:CCGGCTGTGCAGTCTACAATCAATCCTCGAGGATTGATTGTAGACTGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-576s21c1
Sequence:CCGGAGAAGGAGTTGACGAAGATATCTCGAGATATCTTCGTCAACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.1-365s1c1
Sequence:CCGGGCTGTGCAGTCTACAATCAATCTCGAGATTGATTGTAGACTGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.2-313s1c1
Sequence:CCGGGCCATGGTTGAGTTTGCTAAACTCGAGTTTAGCAAACTCAACCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-149s21c1
Sequence:CCGGCAGGTTCTACCCGTTACATATCTCGAGATATGTAACGGGTAGAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.1-529s1c1
Sequence:CCGGGCTGAAGAAGCAATATGGTATCTCGAGATACCATATTGCTTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.1-266s1c1
Sequence:CCGGCTTGTGGAGACTCAAACTGAACTCGAGTTCAGTTTGAGTCTCCACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-286s21c1
Sequence:CCGGGTGAGTAGTGAGTACAGTATGCTCGAGCATACTGTACTCACTACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-465s21c1
Sequence:CCGGGAACTCTGATGCCGACTTTAACTCGAGTTAAAGTCGGCATCAGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026746
VALIDATED
NSMCE2 MISSION shRNA Lentiviral Transduction Particles
non-SMC element 2, MMS21 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-365s21c1
Sequence:CCGGCTGTGCAGTCTACAATCAATCCTCGAGGATTGATTGTAGACTGCACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-576s21c1
Sequence:CCGGAGAAGGAGTTGACGAAGATATCTCGAGATATCTTCGTCAACTCCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.1-365s1c1
Sequence:CCGGGCTGTGCAGTCTACAATCAATCTCGAGATTGATTGTAGACTGCACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.2-313s1c1
Sequence:CCGGGCCATGGTTGAGTTTGCTAAACTCGAGTTTAGCAAACTCAACCATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-149s21c1
Sequence:CCGGCAGGTTCTACCCGTTACATATCTCGAGATATGTAACGGGTAGAACCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.1-529s1c1
Sequence:CCGGGCTGAAGAAGCAATATGGTATCTCGAGATACCATATTGCTTCTTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000180249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026746.1-266s1c1
Sequence:CCGGCTTGTGGAGACTCAAACTGAACTCGAGTTCAGTTTGAGTCTCCACAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-286s21c1
Sequence:CCGGGTGAGTAGTGAGTACAGTATGCTCGAGCATACTGTACTCACTACTCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026746.2-465s21c1
Sequence:CCGGGAACTCTGATGCCGACTTTAACTCGAGTTAAAGTCGGCATCAGAGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???