EMAIL THIS PAGE TO A FRIEND

NSRP1

nuclear speckle splicing regulatory protein 1

57 Gene Product Result for
Synonyms: CCDC55 HSPC095 NSrp70
UniProtKB ID: Q9H0G5, Q6FI71
Gene ID:
Rat(303346) nuclear speckle splicing regulatory protein 1
Zebrafish(323926) nuclear speckle splicing regulatory protein 1
chicken(417588) nuclear speckle splicing regulatory protein 1
cow(539841) nuclear speckle splicing regulatory protein 1
domestic cat(101091414) nuclear speckle splicing regulatory protein 1
dog(610752) nuclear speckle splicing regulatory protein 1
sheep(101111561) nuclear speckle splicing regulatory protein 1
domestic guinea pig(100717831) nuclear speckle splicing regulatory protein 1
naked mole-rat(101704967) nuclear speckle splicing regulatory protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032141 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106731 MISSION® esiRNA esiRNA human CCDC55 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033563 Rosetta Predictions human pricing
NM_032141 Rosetta Predictions human pricing
NM_001037189 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126754 predicted 421
2 SASI_Hs01_00126755 predicted 341
3 SASI_Hs01_00126756 predicted 273
4 SASI_Hs01_00126757 predicted 2539
5 SASI_Hs01_00126758 predicted 2039
6 SASI_Hs01_00126759 predicted 812
7 SASI_Hs01_00126760 predicted 1525
8 SASI_Hs01_00126761 predicted 1998
9 SASI_Hs01_00126762 predicted 1979
10 SASI_Hs01_00126763 predicted 1767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047661 predicted 1575
2 SASI_Hs01_00047662 predicted 814
3 SASI_Hs01_00047664 predicted 847
4 SASI_Hs01_00047665 predicted 1536
5 SASI_Hs02_00359370 predicted 780
6 SASI_Hs01_00047666 predicted 812
7 SASI_Hs01_00047667 predicted 1544
8 SASI_Hs01_00047668 predicted 1586
9 SASI_Hs01_00047669 predicted 914
10 SASI_Hs02_00359371 predicted 1562
11 SASI_Hs01_00047660 predicted 933
12 SASI_Hs01_00047663 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087171 predicted 1689
2 SASI_Rn01_00087173 predicted 1659
3 SASI_Rn01_00087174 predicted 921
4 SASI_Rn01_00087175 predicted 906
5 SASI_Rn01_00087176 predicted 724
6 SASI_Rn01_00087177 predicted 771
7 SASI_Rn01_00087178 predicted 1549
8 SASI_Rn01_00087179 predicted 1594
9 SASI_Rn02_00204278 predicted 1564
10 SASI_Rn02_00204279 predicted 1604
11 SASI_Rn01_00087172 predicted 777
12 SASI_Rn01_00087180 predicted 1672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032141
VALIDATED
NSRP1 MISSION shRNA Bacterial Glycerol Stock
nuclear speckle splicing regulatory protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032141.1-2036s1c1
Sequence:CCGGCGTGCCTGTAATACCAACATTCTCGAGAATGTTGGTATTACAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032141.1-1074s1c1
Sequence:CCGGCCAGTCATAGAGATTCCCATTCTCGAGAATGGGAATCTCTATGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032141.1-1040s1c1
Sequence:CCGGCGGAAAGAAAGGGATTCTCATCTCGAGATGAGAATCCCTTTCTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032141.1-1396s1c1
Sequence:CCGGCAGCCCAAATTCTAGGGCAAACTCGAGTTTGCCCTAGAATTTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032141.1-176s1c1
Sequence:CCGGGCTAAGAAGCAGGCCATGAAACTCGAGTTTCATGGCCTGCTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032141.2-1872s21c1
Sequence:CCGGGTGGATGTTTGGCTGAATTTACTCGAGTAAATTCAGCCAAACATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032141.2-1018s21c1
Sequence:CCGGCCATTACACTGACCGTGATTACTCGAGTAATCACGGTCAGTGTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032141.2-1956s21c1
Sequence:CCGGTAATTCCCTGTAGGTACATAACTCGAGTTATGTACCTACAGGGAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032141.2-1665s21c1
Sequence:CCGGGGGTTAATGCAAAGACCTATACTCGAGTATAGGTCTTTGCATTAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032141
VALIDATED
NSRP1 MISSION shRNA shRNA Plasmid DNA
nuclear speckle splicing regulatory protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032141.1-2036s1c1
Sequence:CCGGCGTGCCTGTAATACCAACATTCTCGAGAATGTTGGTATTACAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032141.1-1074s1c1
Sequence:CCGGCCAGTCATAGAGATTCCCATTCTCGAGAATGGGAATCTCTATGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032141.1-1040s1c1
Sequence:CCGGCGGAAAGAAAGGGATTCTCATCTCGAGATGAGAATCCCTTTCTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032141.1-1396s1c1
Sequence:CCGGCAGCCCAAATTCTAGGGCAAACTCGAGTTTGCCCTAGAATTTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032141.1-176s1c1
Sequence:CCGGGCTAAGAAGCAGGCCATGAAACTCGAGTTTCATGGCCTGCTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032141.2-1872s21c1
Sequence:CCGGGTGGATGTTTGGCTGAATTTACTCGAGTAAATTCAGCCAAACATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032141.2-1018s21c1
Sequence:CCGGCCATTACACTGACCGTGATTACTCGAGTAATCACGGTCAGTGTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032141.2-1956s21c1
Sequence:CCGGTAATTCCCTGTAGGTACATAACTCGAGTTATGTACCTACAGGGAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032141.2-1665s21c1
Sequence:CCGGGGGTTAATGCAAAGACCTATACTCGAGTATAGGTCTTTGCATTAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032141
VALIDATED
NSRP1 MISSION shRNA Lentiviral Transduction Particles
nuclear speckle splicing regulatory protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032141.1-2036s1c1
Sequence:CCGGCGTGCCTGTAATACCAACATTCTCGAGAATGTTGGTATTACAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032141.1-1074s1c1
Sequence:CCGGCCAGTCATAGAGATTCCCATTCTCGAGAATGGGAATCTCTATGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032141.1-1040s1c1
Sequence:CCGGCGGAAAGAAAGGGATTCTCATCTCGAGATGAGAATCCCTTTCTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032141.1-1396s1c1
Sequence:CCGGCAGCCCAAATTCTAGGGCAAACTCGAGTTTGCCCTAGAATTTGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032141.1-176s1c1
Sequence:CCGGGCTAAGAAGCAGGCCATGAAACTCGAGTTTCATGGCCTGCTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032141.2-1872s21c1
Sequence:CCGGGTGGATGTTTGGCTGAATTTACTCGAGTAAATTCAGCCAAACATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032141.2-1018s21c1
Sequence:CCGGCCATTACACTGACCGTGATTACTCGAGTAATCACGGTCAGTGTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032141.2-1956s21c1
Sequence:CCGGTAATTCCCTGTAGGTACATAACTCGAGTTATGTACCTACAGGGAATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032141.2-1665s21c1
Sequence:CCGGGGGTTAATGCAAAGACCTATACTCGAGTATAGGTCTTTGCATTAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)