EMAIL THIS PAGE TO A FRIEND

NSUN4

NOP2/Sun domain family, member 4

223 Gene Product Result for
Synonyms: RP4-603I14.2 SHTAP
Gene ID:
Mouse(72181) NOL1/NOP2/Sun domain family, member 4
Rat(298426) NOP2/Sun domain family, member 4
sheep(101103101) NOP2/Sun domain family, member 4
naked mole-rat(101721265) NOP2/Sun domain family, member 4
Domestic Rabbit(100343475) NOP2/Sun domain family, member 4
domestic guinea pig(100732440) NOP2/Sun domain family, member 4
Zebrafish(494106) NOL1/NOP2/Sun domain family, member 4
cow(618779) NOP2/Sun domain family, member 4
domestic cat(101095274) NOP2/Sun domain family, member 4
dog(610446) NOP2/Sun domain family, member 4
chicken(424613) NOP2/Sun domain family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199044 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199044 Rosetta Predictions human pricing
NM_001106678 Rosetta Predictions rat pricing
NM_028142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046368 predicted 744
2 SASI_Hs01_00046369 predicted 1296
3 SASI_Hs02_00372530 predicted 1187
4 SASI_Hs01_00046370 predicted 211
5 SASI_Hs01_00046372 predicted 737
6 SASI_Hs02_00372531 predicted 274
7 SASI_Hs01_00046373 predicted 931
8 SASI_Hs02_00372532 predicted 740
9 SASI_Hs01_00046374 predicted 1276
10 SASI_Hs01_00046376 predicted 694
11 SASI_Hs01_00046371 predicted 1253
12 SASI_Hs01_00046375 predicted 261
13 SASI_Hs01_00046377 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221308 predicted 608
2 SASI_Rn02_00221309 predicted 833
3 SASI_Rn02_00221310 predicted 1205
4 SASI_Rn02_00221311 predicted 745
5 SASI_Rn02_00221312 predicted 723
6 SASI_Rn02_00221313 predicted 999
7 SASI_Rn02_00221314 predicted 844
8 SASI_Rn02_00221315 predicted 248
9 SASI_Rn02_00221316 predicted 313
10 SASI_Rn02_00221317 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096427 predicted 742
2 SASI_Mm01_00096428 predicted 319
3 SASI_Mm01_00096429 predicted 829
4 SASI_Mm01_00096430 predicted 289
5 SASI_Mm01_00096431 predicted 1203
6 SASI_Mm01_00096432 predicted 652
7 SASI_Mm01_00096433 predicted 855
8 SASI_Mm01_00096434 predicted 1029
9 SASI_Mm01_00096435 predicted 784
10 SASI_Mm01_00096436 predicted 895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028142
VALIDATED
NSUN4 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028142.3-1482s21c1
Sequence:CCGGGCCCATAGTTTAAGCTGTAAACTCGAGTTTACAGCTTAAACTATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028142.3-1177s21c1
Sequence:CCGGGCTGGTAATACCAAACCTCATCTCGAGATGAGGTTTGGTATTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028142.3-999s21c1
Sequence:CCGGGTCACGTTGTCTATTCAACTTCTCGAGAAGTTGAATAGACAACGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028142.3-166s21c1
Sequence:CCGGGCGGAGATATCGATATAAGAACTCGAGTTCTTATATCGATATCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028142.1-1483s1c1
Sequence:CCGGGCCCATAGTTTAAGCTGTAAACTCGAGTTTACAGCTTAAACTATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028142.1-831s1c1
Sequence:CCGGGACACCTATGATAGGGTGTTACTCGAGTAACACCCTATCATAGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028142.1-1000s1c1
Sequence:CCGGGTCACGTTGTCTATTCAACTTCTCGAGAAGTTGAATAGACAACGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028142.1-167s1c1
Sequence:CCGGGCGGAGATATCGATATAAGAACTCGAGTTCTTATATCGATATCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028142.1-1178s1c1
Sequence:CCGGGCTGGTAATACCAAACCTCATCTCGAGATGAGGTTTGGTATTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028142
VALIDATED
NSUN4 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028142.3-1482s21c1
Sequence:CCGGGCCCATAGTTTAAGCTGTAAACTCGAGTTTACAGCTTAAACTATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028142.3-1177s21c1
Sequence:CCGGGCTGGTAATACCAAACCTCATCTCGAGATGAGGTTTGGTATTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028142.3-999s21c1
Sequence:CCGGGTCACGTTGTCTATTCAACTTCTCGAGAAGTTGAATAGACAACGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028142.3-166s21c1
Sequence:CCGGGCGGAGATATCGATATAAGAACTCGAGTTCTTATATCGATATCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028142.1-1483s1c1
Sequence:CCGGGCCCATAGTTTAAGCTGTAAACTCGAGTTTACAGCTTAAACTATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028142.1-831s1c1
Sequence:CCGGGACACCTATGATAGGGTGTTACTCGAGTAACACCCTATCATAGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028142.1-1000s1c1
Sequence:CCGGGTCACGTTGTCTATTCAACTTCTCGAGAAGTTGAATAGACAACGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028142.1-167s1c1
Sequence:CCGGGCGGAGATATCGATATAAGAACTCGAGTTCTTATATCGATATCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028142.1-1178s1c1
Sequence:CCGGGCTGGTAATACCAAACCTCATCTCGAGATGAGGTTTGGTATTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028142
VALIDATED
NSUN4 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028142.3-1482s21c1
Sequence:CCGGGCCCATAGTTTAAGCTGTAAACTCGAGTTTACAGCTTAAACTATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028142.3-1177s21c1
Sequence:CCGGGCTGGTAATACCAAACCTCATCTCGAGATGAGGTTTGGTATTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028142.3-999s21c1
Sequence:CCGGGTCACGTTGTCTATTCAACTTCTCGAGAAGTTGAATAGACAACGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028142.3-166s21c1
Sequence:CCGGGCGGAGATATCGATATAAGAACTCGAGTTCTTATATCGATATCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028142.1-1483s1c1
Sequence:CCGGGCCCATAGTTTAAGCTGTAAACTCGAGTTTACAGCTTAAACTATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028142.1-831s1c1
Sequence:CCGGGACACCTATGATAGGGTGTTACTCGAGTAACACCCTATCATAGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028142.1-1000s1c1
Sequence:CCGGGTCACGTTGTCTATTCAACTTCTCGAGAAGTTGAATAGACAACGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028142.1-167s1c1
Sequence:CCGGGCGGAGATATCGATATAAGAACTCGAGTTCTTATATCGATATCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028142.1-1178s1c1
Sequence:CCGGGCTGGTAATACCAAACCTCATCTCGAGATGAGGTTTGGTATTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199044
VALIDATED
NSUN4 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-489s1c1
Sequence:CCGGCGAACCTTCGATGCTTCACTTCTCGAGAAGTGAAGCATCGAAGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-174s1c1
Sequence:CCGGCGCGGAGACATCGATATAAGACTCGAGTCTTATATCGATGTCTCCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-2666s1c1
Sequence:CCGGGCTAGGAAGATGGAGCTTTAACTCGAGTTAAAGCTCCATCTTCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-332s1c1
Sequence:CCGGGCACTGGTCAATAACTTTGCTCTCGAGAGCAAAGTTATTGACCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-175s1c1
Sequence:CCGGGCGGAGACATCGATATAAGAACTCGAGTTCTTATATCGATGTCTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-1195s1c1
Sequence:CCGGGCTGGTAATACCAAACCTCATCTCGAGATGAGGTTTGGTATTACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-788s1c1
Sequence:CCGGGATGGAAATCAAGTTCGAGTTCTCGAGAACTCGAACTTGATTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-1398s1c1
Sequence:CCGGCGGCAATAAGAAGTAGAAGATCTCGAGATCTTCTACTTCTTATTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199044.2-3293s1c1
Sequence:CCGGCCCTTTCTAAATGAAAGGTTTCTCGAGAAACCTTTCATTTAGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199044.2-758s1c1
Sequence:CCGGCTTCACAGCTATGTGCCTGAACTCGAGTTCAGGCACATAGCTGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199044
VALIDATED
NSUN4 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-489s1c1
Sequence:CCGGCGAACCTTCGATGCTTCACTTCTCGAGAAGTGAAGCATCGAAGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-174s1c1
Sequence:CCGGCGCGGAGACATCGATATAAGACTCGAGTCTTATATCGATGTCTCCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-2666s1c1
Sequence:CCGGGCTAGGAAGATGGAGCTTTAACTCGAGTTAAAGCTCCATCTTCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-332s1c1
Sequence:CCGGGCACTGGTCAATAACTTTGCTCTCGAGAGCAAAGTTATTGACCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-175s1c1
Sequence:CCGGGCGGAGACATCGATATAAGAACTCGAGTTCTTATATCGATGTCTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-1195s1c1
Sequence:CCGGGCTGGTAATACCAAACCTCATCTCGAGATGAGGTTTGGTATTACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-788s1c1
Sequence:CCGGGATGGAAATCAAGTTCGAGTTCTCGAGAACTCGAACTTGATTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-1398s1c1
Sequence:CCGGCGGCAATAAGAAGTAGAAGATCTCGAGATCTTCTACTTCTTATTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199044.2-3293s1c1
Sequence:CCGGCCCTTTCTAAATGAAAGGTTTCTCGAGAAACCTTTCATTTAGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199044.2-758s1c1
Sequence:CCGGCTTCACAGCTATGTGCCTGAACTCGAGTTCAGGCACATAGCTGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199044
VALIDATED
NSUN4 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-489s1c1
Sequence:CCGGCGAACCTTCGATGCTTCACTTCTCGAGAAGTGAAGCATCGAAGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-174s1c1
Sequence:CCGGCGCGGAGACATCGATATAAGACTCGAGTCTTATATCGATGTCTCCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-2666s1c1
Sequence:CCGGGCTAGGAAGATGGAGCTTTAACTCGAGTTAAAGCTCCATCTTCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-332s1c1
Sequence:CCGGGCACTGGTCAATAACTTTGCTCTCGAGAGCAAAGTTATTGACCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-175s1c1
Sequence:CCGGGCGGAGACATCGATATAAGAACTCGAGTTCTTATATCGATGTCTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-1195s1c1
Sequence:CCGGGCTGGTAATACCAAACCTCATCTCGAGATGAGGTTTGGTATTACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-788s1c1
Sequence:CCGGGATGGAAATCAAGTTCGAGTTCTCGAGAACTCGAACTTGATTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_199044.2-1398s1c1
Sequence:CCGGCGGCAATAAGAAGTAGAAGATCTCGAGATCTTCTACTTCTTATTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199044.2-3293s1c1
Sequence:CCGGCCCTTTCTAAATGAAAGGTTTCTCGAGAAACCTTTCATTTAGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199044.2-758s1c1
Sequence:CCGGCTTCACAGCTATGTGCCTGAACTCGAGTTCAGGCACATAGCTGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)