EMAIL THIS PAGE TO A FRIEND

NSUN5

NOP2/Sun domain family, member 5

78 Gene Product Result for
Synonyms: NOL1 NOL1R NSUN5A WBSCR20 WBSCR20A p120
Gene ID:
Human(55695) Summary: This gene encodes a member of the evolutionarily conserved NOL1/NOP2/Sun domain family. The encoded protein may function as a DNA methyltransferase in the nucleus. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2009]
Mouse(100609) NOL1/NOP2/Sun domain family, member 5
Rat(288595) NOP2/Sun domain family, member 5
Zebrafish(406690) NOP2/Sun domain family, member 5
chicken(417462) NOP2/Sun domain family, member 5
dog(479720) NOP2/Sun domain family, member 5
cow(616714) NOP2/Sun domain family, member 5
domestic cat(101086773) NOP2/Sun domain family, member 5
domestic guinea pig(100716640) NOP2/Sun domain family, member 5
naked mole-rat(101710147) NOP2/Sun domain family, member 5
sheep(101114486) NOP2/Sun domain family, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148956 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018044 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018044 Rosetta Predictions human pricing
NM_148956 Rosetta Predictions human pricing
XM_001071177 Rosetta Predictions rat pricing
XM_213749 Rosetta Predictions rat pricing
NM_145414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119885 predicted 476
2 SASI_Hs01_00119886 predicted 528
3 SASI_Hs01_00119887 predicted 911
4 SASI_Hs01_00119888 predicted 854
5 SASI_Hs01_00119889 predicted 471
6 SASI_Hs01_00119890 predicted 474
7 SASI_Hs01_00119891 predicted 521
8 SASI_Hs01_00119892 predicted 243
9 SASI_Hs02_00351165 predicted 461
10 SASI_Hs01_00119893 predicted 371
11 SASI_Hs01_00119894 predicted 37
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111079 predicted 469
2 SASI_Hs01_00111080 predicted 528
3 SASI_Hs01_00111081 predicted 914
4 SASI_Hs01_00111082 predicted 858
5 SASI_Hs01_00111083 predicted 469
6 SASI_Hs01_00111084 predicted 476
7 SASI_Hs01_00111085 predicted 529
8 SASI_Hs01_00111086 predicted 243
9 SASI_Hs02_00365667 predicted 458
10 SASI_Hs01_00111087 predicted 368
11 SASI_Hs01_00111088 predicted 1578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334107 predicted 486
2 SASI_Rn02_00334108 predicted 1602
3 SASI_Rn02_00334109 predicted 474
4 SASI_Rn02_00334110 predicted 1541
5 SASI_Rn02_00334111 predicted 905
6 SASI_Rn02_00334112 predicted 1479
7 SASI_Rn02_00334113 predicted 1605
8 SASI_Rn02_00334114 predicted 1082
9 SASI_Rn02_00334115 predicted 1484
10 SASI_Rn02_00334116 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374885 predicted 484
2 SASI_Rn02_00374886 predicted 1605
3 SASI_Rn02_00374887 predicted 469
4 SASI_Rn02_00374888 predicted 1537
5 SASI_Rn02_00374889 predicted 903
6 SASI_Rn02_00374890 predicted 1473
7 SASI_Rn02_00374891 predicted 1608
8 SASI_Rn02_00374892 predicted 1084
9 SASI_Rn02_00374893 predicted 1482
10 SASI_Rn02_00374894 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340751 predicted 1562
2 SASI_Mm02_00340752 predicted 1570
3 SASI_Mm02_00340753 predicted 1628
4 SASI_Mm02_00340754 predicted 736
5 SASI_Mm01_00167221 predicted 907
6 SASI_Mm02_00340755 predicted 1577
7 SASI_Mm01_00167222 predicted 749
8 SASI_Mm02_00340756 predicted 1204
9 SASI_Mm02_00340757 predicted 1613
10 SASI_Mm02_00340758 predicted 612
11 SASI_Mm01_00167216 predicted 432
12 SASI_Mm01_00167217 predicted 1355
13 SASI_Mm01_00167218 predicted 1183
14 SASI_Mm01_00167219 predicted 1332
15 SASI_Mm01_00167220 predicted 1170
16 SASI_Mm01_00167223 predicted 239
17 SASI_Mm01_00167224 predicted 570
18 SASI_Mm01_00167225 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148956
NSUN5 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148956.1-248s1c1
Sequence:CCGGCCAAGGTGCTAGTGTATGAGTCTCGAGACTCATACACTAGCACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148956.2-479s21c1
Sequence:CCGGGCCTCGATTTGTGCGTGTGAACTCGAGTTCACACGCACAAATCGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148956.1-498s1c1
Sequence:CCGGCAAGAGACAAGGTTTCTCCTACTCGAGTAGGAGAAACCTTGTCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148956.1-249s1c1
Sequence:CCGGCAAGGTGCTAGTGTATGAGTTCTCGAGAACTCATACACTAGCACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148956.2-1652s21c1
Sequence:CCGGAGAACGTACTCTACGATAGATCTCGAGATCTATCGTAGAGTACGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148956
NSUN5 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148956.1-248s1c1
Sequence:CCGGCCAAGGTGCTAGTGTATGAGTCTCGAGACTCATACACTAGCACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148956.2-479s21c1
Sequence:CCGGGCCTCGATTTGTGCGTGTGAACTCGAGTTCACACGCACAAATCGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148956.1-498s1c1
Sequence:CCGGCAAGAGACAAGGTTTCTCCTACTCGAGTAGGAGAAACCTTGTCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148956.1-249s1c1
Sequence:CCGGCAAGGTGCTAGTGTATGAGTTCTCGAGAACTCATACACTAGCACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148956.2-1652s21c1
Sequence:CCGGAGAACGTACTCTACGATAGATCTCGAGATCTATCGTAGAGTACGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148956
NSUN5 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148956.1-248s1c1
Sequence:CCGGCCAAGGTGCTAGTGTATGAGTCTCGAGACTCATACACTAGCACCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148956.2-479s21c1
Sequence:CCGGGCCTCGATTTGTGCGTGTGAACTCGAGTTCACACGCACAAATCGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148956.1-498s1c1
Sequence:CCGGCAAGAGACAAGGTTTCTCCTACTCGAGTAGGAGAAACCTTGTCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148956.1-249s1c1
Sequence:CCGGCAAGGTGCTAGTGTATGAGTTCTCGAGAACTCATACACTAGCACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148956.2-1652s21c1
Sequence:CCGGAGAACGTACTCTACGATAGATCTCGAGATCTATCGTAGAGTACGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145414
VALIDATED
NSUN5 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-471s21c1
Sequence:CCGGCTGAGGATGCAATCGATTATTCTCGAGAATAATCGATTGCATCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-464s1c1
Sequence:CCGGCTGAGGATGCAATCGATTATTCTCGAGAATAATCGATTGCATCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145414.1-1447s1c1
Sequence:CCGGGAACCATGCTTACTGTGGGAACTCGAGTTCCCACAGTAAGCATGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-577s1c1
Sequence:CCGGCTGCCTGAGCTTCTTGTATTTCTCGAGAAATACAAGAAGCTCAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-749s1c1
Sequence:CCGGGCTACATTGCAGCCCTTCTAACTCGAGTTAGAAGGGCTGCAATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-235s1c1
Sequence:CCGGGCCAAGGTGCTAGTGTATGAACTCGAGTTCATACACTAGCACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-584s21c1
Sequence:CCGGCTGCCTGAGCTTCTTGTATTTCTCGAGAAATACAAGAAGCTCAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-242s21c1
Sequence:CCGGGCCAAGGTGCTAGTGTATGAACTCGAGTTCATACACTAGCACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-756s21c1
Sequence:CCGGGCTACATTGCAGCCCTTCTAACTCGAGTTAGAAGGGCTGCAATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145414
VALIDATED
NSUN5 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-471s21c1
Sequence:CCGGCTGAGGATGCAATCGATTATTCTCGAGAATAATCGATTGCATCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-464s1c1
Sequence:CCGGCTGAGGATGCAATCGATTATTCTCGAGAATAATCGATTGCATCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145414.1-1447s1c1
Sequence:CCGGGAACCATGCTTACTGTGGGAACTCGAGTTCCCACAGTAAGCATGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-577s1c1
Sequence:CCGGCTGCCTGAGCTTCTTGTATTTCTCGAGAAATACAAGAAGCTCAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-749s1c1
Sequence:CCGGGCTACATTGCAGCCCTTCTAACTCGAGTTAGAAGGGCTGCAATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-235s1c1
Sequence:CCGGGCCAAGGTGCTAGTGTATGAACTCGAGTTCATACACTAGCACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-584s21c1
Sequence:CCGGCTGCCTGAGCTTCTTGTATTTCTCGAGAAATACAAGAAGCTCAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-242s21c1
Sequence:CCGGGCCAAGGTGCTAGTGTATGAACTCGAGTTCATACACTAGCACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-756s21c1
Sequence:CCGGGCTACATTGCAGCCCTTCTAACTCGAGTTAGAAGGGCTGCAATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145414
VALIDATED
NSUN5 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-471s21c1
Sequence:CCGGCTGAGGATGCAATCGATTATTCTCGAGAATAATCGATTGCATCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-464s1c1
Sequence:CCGGCTGAGGATGCAATCGATTATTCTCGAGAATAATCGATTGCATCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145414.1-1447s1c1
Sequence:CCGGGAACCATGCTTACTGTGGGAACTCGAGTTCCCACAGTAAGCATGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-577s1c1
Sequence:CCGGCTGCCTGAGCTTCTTGTATTTCTCGAGAAATACAAGAAGCTCAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-749s1c1
Sequence:CCGGGCTACATTGCAGCCCTTCTAACTCGAGTTAGAAGGGCTGCAATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145414.1-235s1c1
Sequence:CCGGGCCAAGGTGCTAGTGTATGAACTCGAGTTCATACACTAGCACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-584s21c1
Sequence:CCGGCTGCCTGAGCTTCTTGTATTTCTCGAGAAATACAAGAAGCTCAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-242s21c1
Sequence:CCGGGCCAAGGTGCTAGTGTATGAACTCGAGTTCATACACTAGCACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145414.2-756s21c1
Sequence:CCGGGCTACATTGCAGCCCTTCTAACTCGAGTTAGAAGGGCTGCAATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018044
NSUN5 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 5
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000139265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018044.2-746s1c1
Sequence:CCGGCAGGCAATAAGACCAGTCACTCTCGAGAGTGACTGGTCTTATTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018044.2-1366s1c1
Sequence:CCGGGCACATCTAACATCTACACTTCTCGAGAAGTGTAGATGTTAGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018044
NSUN5 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 5
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000139265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018044.2-746s1c1
Sequence:CCGGCAGGCAATAAGACCAGTCACTCTCGAGAGTGACTGGTCTTATTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018044.2-1366s1c1
Sequence:CCGGGCACATCTAACATCTACACTTCTCGAGAAGTGTAGATGTTAGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018044
NSUN5 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 5
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000139265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018044.2-746s1c1
Sequence:CCGGCAGGCAATAAGACCAGTCACTCTCGAGAGTGACTGGTCTTATTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018044.2-1366s1c1
Sequence:CCGGGCACATCTAACATCTACACTTCTCGAGAAGTGTAGATGTTAGATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)