EMAIL THIS PAGE TO A FRIEND

NSUN5P1

NOP2/Sun domain family, member 5 pseudogene 1

26 Gene Product Result for
Synonyms: NSUN5B WBSCR20B
Species: Human NSUN5P1(155400)
UniProtKB ID: Q3KNT7, B3KX24, Q52LC6, Q8N728
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039575 Rosetta Predictions human pricing
NM_001039576 Rosetta Predictions human pricing
NM_145645 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230433 predicted 1476
2 SASI_Hs01_00230439 predicted 1479
3 SASI_Hs02_00308570 predicted 1345
4 SASI_Hs01_00230431 predicted 1494
5 SASI_Hs01_00230432 predicted 1358
6 SASI_Hs01_00230434 predicted 1544
7 SASI_Hs01_00230435 predicted 1496
8 SASI_Hs01_00230436 predicted 1612
9 SASI_Hs01_00230437 predicted 1220
10 SASI_Hs01_00230438 predicted 1440
11 SASI_Hs01_00230440 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203634 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013293 predicted 1373
2 SASI_Hs01_00013299 predicted 1375
3 SASI_Hs02_00365263 predicted 1240
4 SASI_Hs01_00013291 predicted 1383
5 SASI_Hs01_00013292 predicted 1256
6 SASI_Hs01_00013294 predicted 1438
7 SASI_Hs01_00013295 predicted 1391
8 SASI_Hs01_00013296 predicted 1497
9 SASI_Hs01_00013297 predicted 1121
10 SASI_Hs01_00013298 predicted 1328
11 SASI_Hs01_00013300 predicted 1443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145645
NSUN5P1 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 5 pseudogene 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1133s1c1
Sequence:CCGGCCAGGAGGAGAATGAAGACATCTCGAGATGTCTTCATTCTCCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1142s1c1
Sequence:CCGGGAATGAAGACATGGTACCAGACTCGAGTCTGGTACCATGTCTTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1137s1c1
Sequence:CCGGGAGGAGAATGAAGACATGGTACTCGAGTACCATGTCTTCATTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1295s1c1
Sequence:CCGGCTTCTTCGTTGCTGTAATTGACTCGAGTCAATTACAGCAACGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1391s1c1
Sequence:CCGGGAGAAAGAAGAGACAGCAAAGCTCGAGCTTTGCTGTCTCTTCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1140s1c1
Sequence:CCGGGAGAATGAAGACATGGTACCACTCGAGTGGTACCATGTCTTCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145645
NSUN5P1 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 5 pseudogene 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1133s1c1
Sequence:CCGGCCAGGAGGAGAATGAAGACATCTCGAGATGTCTTCATTCTCCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1142s1c1
Sequence:CCGGGAATGAAGACATGGTACCAGACTCGAGTCTGGTACCATGTCTTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1137s1c1
Sequence:CCGGGAGGAGAATGAAGACATGGTACTCGAGTACCATGTCTTCATTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1295s1c1
Sequence:CCGGCTTCTTCGTTGCTGTAATTGACTCGAGTCAATTACAGCAACGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1391s1c1
Sequence:CCGGGAGAAAGAAGAGACAGCAAAGCTCGAGCTTTGCTGTCTCTTCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1140s1c1
Sequence:CCGGGAGAATGAAGACATGGTACCACTCGAGTGGTACCATGTCTTCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145645
NSUN5P1 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 5 pseudogene 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1133s1c1
Sequence:CCGGCCAGGAGGAGAATGAAGACATCTCGAGATGTCTTCATTCTCCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1142s1c1
Sequence:CCGGGAATGAAGACATGGTACCAGACTCGAGTCTGGTACCATGTCTTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1137s1c1
Sequence:CCGGGAGGAGAATGAAGACATGGTACTCGAGTACCATGTCTTCATTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1295s1c1
Sequence:CCGGCTTCTTCGTTGCTGTAATTGACTCGAGTCAATTACAGCAACGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1391s1c1
Sequence:CCGGGAGAAAGAAGAGACAGCAAAGCTCGAGCTTTGCTGTCTCTTCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145645.1-1140s1c1
Sequence:CCGGGAGAATGAAGACATGGTACCACTCGAGTGGTACCATGTCTTCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)