EMAIL THIS PAGE TO A FRIEND

NSUN5P2

NOP2/Sun domain family, member 5 pseudogene 2

64 Gene Product Result for
Synonyms: NOL1R2 NSUN5C WBSCR20B WBSCR20C
Species: Human NSUN5P2(260294)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302894 ANTI-NSN5C (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
AV48960 Anti-NSUN5C antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, rabbit, horse, canine, bovine, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032158 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_149379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_149379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_149379 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148980 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039487 Rosetta Predictions human pricing
NM_032158 Rosetta Predictions human pricing
NM_148936 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308527 predicted 892
2 SASI_Hs01_00049023 predicted 328
3 SASI_Hs01_00049024 predicted 329
4 SASI_Hs02_00308528 predicted 885
5 SASI_Hs02_00308529 predicted 502
6 SASI_Hs02_00308530 predicted 501
7 SASI_Hs02_00308531 predicted 495
8 SASI_Hs02_00308532 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010684 predicted 1424
2 SASI_Hs01_00010688 predicted 862
3 SASI_Hs01_00010689 predicted 870
4 SASI_Hs01_00010690 predicted 1423
5 SASI_Hs02_00359396 predicted 1034
6 SASI_Hs02_00359397 predicted 1033
7 SASI_Hs02_00359398 predicted 1026
8 SASI_Hs02_00359399 predicted 1036
9 SASI_Hs01_00010681 predicted 910
10 SASI_Hs01_00010682 predicted 1449
11 SASI_Hs01_00010683 predicted 898
12 SASI_Hs01_00010685 predicted 883
13 SASI_Hs01_00010686 predicted 882
14 SASI_Hs01_00010687 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024203 predicted 1351
2 SASI_Hs01_00024207 predicted 862
3 SASI_Hs01_00024208 predicted 868
4 SASI_Hs01_00024209 predicted 1357
5 SASI_Hs02_00365658 predicted 1036
6 SASI_Hs02_00365659 predicted 1033
7 SASI_Hs02_00365660 predicted 1127
8 SASI_Hs02_00365661 predicted 1032
9 SASI_Hs02_00365662 predicted 1043
10 SASI_Hs01_00024200 predicted 919
11 SASI_Hs01_00024201 predicted 1378
12 SASI_Hs01_00024202 predicted 889
13 SASI_Hs01_00024204 predicted 880
14 SASI_Hs01_00024205 predicted 887
15 SASI_Hs01_00024206 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032158
VALIDATED
NSUN5P2 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 5 pseudogene 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-845s1c1
Sequence:CCGGGCAATAAAGACCAGTCACTTGCTCGAGCAAGTGACTGGTCTTTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-712s1c1
Sequence:CCGGCCAGACAGATCTGCATGAACACTCGAGTGTTCATGCAGATCTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032158.2-1219s1c1
Sequence:CCGGCCAGGAGGAGAATGAAGACATCTCGAGATGTCTTCATTCTCCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-862s1c1
Sequence:CCGGCTTGGCTGCTCTTCTGAAGAACTCGAGTTCTTCAGAAGAGCAGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032158.2-841s1c1
Sequence:CCGGCCAGGCAATAAAGACCAGTCACTCGAGTGACTGGTCTTTATTGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032158.2-883s1c1
Sequence:CCGGCCAAGGGAAGATCTTTGCCTTCTCGAGAAGGCAAAGATCTTCCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032158.2-1387s1c1
Sequence:CCGGCGTTGCTGTAATTGAACGGGTCTCGAGACCCGTTCAATTACAGCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032158.2-866s1c1
Sequence:CCGGGCTGCTCTTCTGAAGAACCAACTCGAGTTGGTTCTTCAGAAGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032158.2-884s1c1
Sequence:CCGGCAAGGGAAGATCTTTGCCTTTCTCGAGAAAGGCAAAGATCTTCCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-1223s1c1
Sequence:CCGGGAGGAGAATGAAGACATGGTACTCGAGTACCATGTCTTCATTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032158.2-877s1c1
Sequence:CCGGGAAGAACCAAGGGAAGATCTTCTCGAGAAGATCTTCCCTTGGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-1226s1c1
Sequence:CCGGGAGAATGAAGACATGGTACAACTCGAGTTGTACCATGTCTTCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032158.2-1473s1c1
Sequence:CCGGCAAAGAGAAAGAAGAGAGCAACTCGAGTTGCTCTCTTCTTTCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032158
VALIDATED
NSUN5P2 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 5 pseudogene 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-845s1c1
Sequence:CCGGGCAATAAAGACCAGTCACTTGCTCGAGCAAGTGACTGGTCTTTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-712s1c1
Sequence:CCGGCCAGACAGATCTGCATGAACACTCGAGTGTTCATGCAGATCTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032158.2-1219s1c1
Sequence:CCGGCCAGGAGGAGAATGAAGACATCTCGAGATGTCTTCATTCTCCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-862s1c1
Sequence:CCGGCTTGGCTGCTCTTCTGAAGAACTCGAGTTCTTCAGAAGAGCAGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032158.2-841s1c1
Sequence:CCGGCCAGGCAATAAAGACCAGTCACTCGAGTGACTGGTCTTTATTGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032158.2-883s1c1
Sequence:CCGGCCAAGGGAAGATCTTTGCCTTCTCGAGAAGGCAAAGATCTTCCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032158.2-1387s1c1
Sequence:CCGGCGTTGCTGTAATTGAACGGGTCTCGAGACCCGTTCAATTACAGCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032158.2-866s1c1
Sequence:CCGGGCTGCTCTTCTGAAGAACCAACTCGAGTTGGTTCTTCAGAAGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032158.2-884s1c1
Sequence:CCGGCAAGGGAAGATCTTTGCCTTTCTCGAGAAAGGCAAAGATCTTCCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-1223s1c1
Sequence:CCGGGAGGAGAATGAAGACATGGTACTCGAGTACCATGTCTTCATTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032158.2-877s1c1
Sequence:CCGGGAAGAACCAAGGGAAGATCTTCTCGAGAAGATCTTCCCTTGGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-1226s1c1
Sequence:CCGGGAGAATGAAGACATGGTACAACTCGAGTTGTACCATGTCTTCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032158.2-1473s1c1
Sequence:CCGGCAAAGAGAAAGAAGAGAGCAACTCGAGTTGCTCTCTTCTTTCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032158
VALIDATED
NSUN5P2 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 5 pseudogene 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-845s1c1
Sequence:CCGGGCAATAAAGACCAGTCACTTGCTCGAGCAAGTGACTGGTCTTTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-712s1c1
Sequence:CCGGCCAGACAGATCTGCATGAACACTCGAGTGTTCATGCAGATCTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032158.2-1219s1c1
Sequence:CCGGCCAGGAGGAGAATGAAGACATCTCGAGATGTCTTCATTCTCCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-862s1c1
Sequence:CCGGCTTGGCTGCTCTTCTGAAGAACTCGAGTTCTTCAGAAGAGCAGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032158.2-841s1c1
Sequence:CCGGCCAGGCAATAAAGACCAGTCACTCGAGTGACTGGTCTTTATTGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032158.2-883s1c1
Sequence:CCGGCCAAGGGAAGATCTTTGCCTTCTCGAGAAGGCAAAGATCTTCCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032158.2-1387s1c1
Sequence:CCGGCGTTGCTGTAATTGAACGGGTCTCGAGACCCGTTCAATTACAGCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032158.2-866s1c1
Sequence:CCGGGCTGCTCTTCTGAAGAACCAACTCGAGTTGGTTCTTCAGAAGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032158.2-884s1c1
Sequence:CCGGCAAGGGAAGATCTTTGCCTTTCTCGAGAAAGGCAAAGATCTTCCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-1223s1c1
Sequence:CCGGGAGGAGAATGAAGACATGGTACTCGAGTACCATGTCTTCATTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032158.2-877s1c1
Sequence:CCGGGAAGAACCAAGGGAAGATCTTCTCGAGAAGATCTTCCCTTGGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032158.2-1226s1c1
Sequence:CCGGGAGAATGAAGACATGGTACAACTCGAGTTGTACCATGTCTTCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032158.2-1473s1c1
Sequence:CCGGCAAAGAGAAAGAAGAGAGCAACTCGAGTTGCTCTCTTCTTTCTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_149379
NSUN5P2 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 5 pseudogene 2
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000140119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_149379.1-1386s1c1
Sequence:CCGGGTTGCTGTAATTGAACGGGTCCTCGAGGACCCGTTCAATTACAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_149379
NSUN5P2 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 5 pseudogene 2
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000140119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_149379.1-1386s1c1
Sequence:CCGGGTTGCTGTAATTGAACGGGTCCTCGAGGACCCGTTCAATTACAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_149379
NSUN5P2 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 5 pseudogene 2
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000140119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_149379.1-1386s1c1
Sequence:CCGGGTTGCTGTAATTGAACGGGTCCTCGAGGACCCGTTCAATTACAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148980
VALIDATED
NSUN5P2 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 5 pseudogene 2
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000142404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_148980.1-997s1c1
Sequence:CCGGGAAGATCTTTGCCTTTGACCTCTCGAGAGGTCAAAGGCAAAGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148980.1-1344s1c1
Sequence:CCGGGAATGAAGACATGGTACAAGACTCGAGTCTTGTACCATGTCTTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148980
VALIDATED
NSUN5P2 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 5 pseudogene 2
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000142404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_148980.1-997s1c1
Sequence:CCGGGAAGATCTTTGCCTTTGACCTCTCGAGAGGTCAAAGGCAAAGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148980.1-1344s1c1
Sequence:CCGGGAATGAAGACATGGTACAAGACTCGAGTCTTGTACCATGTCTTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148980
VALIDATED
NSUN5P2 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 5 pseudogene 2
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000142404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_148980.1-997s1c1
Sequence:CCGGGAAGATCTTTGCCTTTGACCTCTCGAGAGGTCAAAGGCAAAGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148980.1-1344s1c1
Sequence:CCGGGAATGAAGACATGGTACAAGACTCGAGTCTTGTACCATGTCTTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)