EMAIL THIS PAGE TO A FRIEND

NSUN6

NOP2/Sun domain family, member 6

49 Gene Product Result for
Synonyms: 4933414E04Rik NOPD1
UniProtKB ID: Q8TEA1, B0YJ54
Gene ID:
Mouse(74455) NOL1/NOP2/Sun domain family member 6
Rat(307148) NOP2/Sun domain family, member 6
chicken(428419) NOP2/Sun domain family, member 6
domestic cat(101093945) NOP2/Sun domain family, member 6
cow(511775) NOP2/Sun domain family, member 6
Horse(100055930) NOP2/Sun domain family, member 6
dog(487112) NOP2/Sun domain family, member 6
sheep(101113514) NOP2/Sun domain family, member 6
naked mole-rat(101715158) NOP2/Sun domain family, member 6
Domestic Rabbit(100345013) NOP2/Sun domain family, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182543 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182543 Rosetta Predictions human pricing
NM_001107367 Rosetta Predictions rat pricing
NM_028950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370651 predicted 1187
2 SASI_Hs01_00019682 predicted 690
3 SASI_Hs01_00019683 predicted 1532
4 SASI_Hs01_00019684 predicted 1362
5 SASI_Hs01_00019685 predicted 1172
6 SASI_Hs01_00019686 predicted 1514
7 SASI_Hs02_00370652 predicted 709
8 SASI_Hs01_00019687 predicted 1122
9 SASI_Hs01_00019688 predicted 972
10 SASI_Hs01_00019689 predicted 1515
11 SASI_Hs01_00019690 predicted 1359
12 SASI_Hs01_00019691 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228125 predicted 315
2 SASI_Rn02_00228126 predicted 744
3 SASI_Rn02_00228127 predicted 894
4 SASI_Rn02_00228128 predicted 926
5 SASI_Rn02_00228129 predicted 702
6 SASI_Rn02_00228130 predicted 1002
7 SASI_Rn02_00228131 predicted 1223
8 SASI_Rn02_00228132 predicted 481
9 SASI_Rn02_00228133 predicted 1297
10 SASI_Rn02_00228134 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197090 predicted 1110
2 SASI_Mm01_00197092 predicted 913
3 SASI_Mm01_00197093 predicted 1388
4 SASI_Mm01_00197094 predicted 932
5 SASI_Mm02_00334678 predicted 1211
6 SASI_Mm01_00197095 predicted 1276
7 SASI_Mm01_00197096 predicted 507
8 SASI_Mm01_00197097 predicted 460
9 SASI_Mm01_00197098 predicted 456
10 SASI_Mm01_00197099 predicted 704
11 SASI_Mm01_00197091 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182543
NSUN6 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1765s1c1
Sequence:CCGGCGTCTGGCTAATAAGGACTCTCTCGAGAGAGTCCTTATTAGCCAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-962s1c1
Sequence:CCGGGCAAAGAAATCTTCAGTGGATCTCGAGATCCACTGAAGATTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-850s1c1
Sequence:CCGGGCTGGAGATGTTATTTCTGTACTCGAGTACAGAAATAACATCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1199s1c1
Sequence:CCGGGAGAAGTTATAGCACTGGATACTCGAGTATCCAGTGCTATAACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1656s1c1
Sequence:CCGGGCTCTCATGTGAACAGTTGAACTCGAGTTCAACTGTTCACATGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-637s1c1
Sequence:CCGGGATGAACTTCAGAAGCAGTTTCTCGAGAAACTGCTTCTGAAGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1768s1c1
Sequence:CCGGCTGGCTAATAAGGACTCTATACTCGAGTATAGAGTCCTTATTAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182543.1-1922s1c1
Sequence:CCGGCAACTGAATGATGATGTGGTTCTCGAGAACCACATCATCATTCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1090s1c1
Sequence:CCGGGCCTTAGTAAGTCATGTACTACTCGAGTAGTACATGACTTACTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-505s1c1
Sequence:CCGGGCTTTAGGTAAACAAGAAGCACTCGAGTGCTTCTTGTTTACCTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182543
NSUN6 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1765s1c1
Sequence:CCGGCGTCTGGCTAATAAGGACTCTCTCGAGAGAGTCCTTATTAGCCAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-962s1c1
Sequence:CCGGGCAAAGAAATCTTCAGTGGATCTCGAGATCCACTGAAGATTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-850s1c1
Sequence:CCGGGCTGGAGATGTTATTTCTGTACTCGAGTACAGAAATAACATCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1199s1c1
Sequence:CCGGGAGAAGTTATAGCACTGGATACTCGAGTATCCAGTGCTATAACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1656s1c1
Sequence:CCGGGCTCTCATGTGAACAGTTGAACTCGAGTTCAACTGTTCACATGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-637s1c1
Sequence:CCGGGATGAACTTCAGAAGCAGTTTCTCGAGAAACTGCTTCTGAAGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1768s1c1
Sequence:CCGGCTGGCTAATAAGGACTCTATACTCGAGTATAGAGTCCTTATTAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182543.1-1922s1c1
Sequence:CCGGCAACTGAATGATGATGTGGTTCTCGAGAACCACATCATCATTCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1090s1c1
Sequence:CCGGGCCTTAGTAAGTCATGTACTACTCGAGTAGTACATGACTTACTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-505s1c1
Sequence:CCGGGCTTTAGGTAAACAAGAAGCACTCGAGTGCTTCTTGTTTACCTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182543
NSUN6 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1765s1c1
Sequence:CCGGCGTCTGGCTAATAAGGACTCTCTCGAGAGAGTCCTTATTAGCCAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-962s1c1
Sequence:CCGGGCAAAGAAATCTTCAGTGGATCTCGAGATCCACTGAAGATTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-850s1c1
Sequence:CCGGGCTGGAGATGTTATTTCTGTACTCGAGTACAGAAATAACATCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1199s1c1
Sequence:CCGGGAGAAGTTATAGCACTGGATACTCGAGTATCCAGTGCTATAACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1656s1c1
Sequence:CCGGGCTCTCATGTGAACAGTTGAACTCGAGTTCAACTGTTCACATGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-637s1c1
Sequence:CCGGGATGAACTTCAGAAGCAGTTTCTCGAGAAACTGCTTCTGAAGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1768s1c1
Sequence:CCGGCTGGCTAATAAGGACTCTATACTCGAGTATAGAGTCCTTATTAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182543.1-1922s1c1
Sequence:CCGGCAACTGAATGATGATGTGGTTCTCGAGAACCACATCATCATTCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-1090s1c1
Sequence:CCGGGCCTTAGTAAGTCATGTACTACTCGAGTAGTACATGACTTACTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182543.1-505s1c1
Sequence:CCGGGCTTTAGGTAAACAAGAAGCACTCGAGTGCTTCTTGTTTACCTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028950
NSUN6 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028950.3-2384s1c1
Sequence:CCGGCGCAGGTCACTTCTAAATAAACTCGAGTTTATTTAGAAGTGACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-1160s1c1
Sequence:CCGGCGATGCAACAAAGGCACTTAACTCGAGTTAAGTGCCTTTGTTGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-1520s1c1
Sequence:CCGGCCTGACATTGGAGCAATTGAACTCGAGTTCAATTGCTCCAATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-1133s1c1
Sequence:CCGGGCTTCATTCTATCCGGGCATTCTCGAGAATGCCCGGATAGAATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-667s1c1
Sequence:CCGGCCCATGTCTATGTTCCAGGAACTCGAGTTCCTGGAACATAGACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028950
NSUN6 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028950.3-2384s1c1
Sequence:CCGGCGCAGGTCACTTCTAAATAAACTCGAGTTTATTTAGAAGTGACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-1160s1c1
Sequence:CCGGCGATGCAACAAAGGCACTTAACTCGAGTTAAGTGCCTTTGTTGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-1520s1c1
Sequence:CCGGCCTGACATTGGAGCAATTGAACTCGAGTTCAATTGCTCCAATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-1133s1c1
Sequence:CCGGGCTTCATTCTATCCGGGCATTCTCGAGAATGCCCGGATAGAATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-667s1c1
Sequence:CCGGCCCATGTCTATGTTCCAGGAACTCGAGTTCCTGGAACATAGACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028950
NSUN6 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028950.3-2384s1c1
Sequence:CCGGCGCAGGTCACTTCTAAATAAACTCGAGTTTATTTAGAAGTGACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-1160s1c1
Sequence:CCGGCGATGCAACAAAGGCACTTAACTCGAGTTAAGTGCCTTTGTTGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-1520s1c1
Sequence:CCGGCCTGACATTGGAGCAATTGAACTCGAGTTCAATTGCTCCAATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-1133s1c1
Sequence:CCGGGCTTCATTCTATCCGGGCATTCTCGAGAATGCCCGGATAGAATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028950.3-667s1c1
Sequence:CCGGCCCATGTCTATGTTCCAGGAACTCGAGTTCCTGGAACATAGACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)