EMAIL THIS PAGE TO A FRIEND

NT5C1A

5'-nucleotidase, cytosolic IA

58 Gene Product Result for
Synonyms: CN-I CN-IA CN1 CN1A CNI
UniProtKB ID: Q9BXI3, Q3SYB9, Q5TG98, Q9BWT8
Gene ID:
Human(84618) Summary: Cytosolic nucleotidases, such as NT5C1A, dephosphorylate nucleoside monophosphates (Hunsucker et al., 2001 [PubMed 11133996]
Mouse(230718) 5'-nucleotidase, cytosolic IA
Rat(313574) 5'-nucleotidase, cytosolic IA
domestic guinea pig(100723874) 5'-nucleotidase, cytosolic IA
naked mole-rat(101714870) 5'-nucleotidase, cytosolic IA
sheep(101119593) 5'-nucleotidase, cytosolic IA
Zebrafish(562627) 5'-nucleotidase, cytosolic IA
chicken(419675) 5'-nucleotidase, cytosolic IA
dog(482463) 5'-nucleotidase, cytosolic IA
cow(504454) 5'-nucleotidase, cytosolic IA
Horse(100054191) 5'-nucleotidase, cytosolic IA
domestic cat(101095997) 5'-nucleotidase, cytosolic IA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032526 Rosetta Predictions human pricing
NM_001107976 Rosetta Predictions rat pricing
NM_001085502 Rosetta Predictions mouse pricing
XM_112246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173336 predicted 361
2 SASI_Hs01_00173337 predicted 488
3 SASI_Hs01_00173338 predicted 458
4 SASI_Hs01_00173339 predicted 247
5 SASI_Hs01_00173340 predicted 771
6 SASI_Hs02_00360025 predicted 430
7 SASI_Hs01_00173341 predicted 337
8 SASI_Hs01_00173342 predicted 236
9 SASI_Hs01_00173343 predicted 376
10 SASI_Hs01_00173344 predicted 818
11 SASI_Hs01_00173345 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234135 predicted 192
2 SASI_Rn02_00234136 predicted 203
3 SASI_Rn02_00234137 predicted 553
4 SASI_Rn02_00234138 predicted 238
5 SASI_Rn02_00234139 predicted 867
6 SASI_Rn02_00234140 predicted 398
7 SASI_Rn02_00234141 predicted 818
8 SASI_Rn02_00234142 predicted 299
9 SASI_Rn02_00234143 predicted 839
10 SASI_Rn02_00234144 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300602 predicted 328
2 SASI_Mm02_00300603 predicted 480
3 SASI_Mm02_00300604 predicted 419
4 SASI_Mm02_00300605 predicted 585
5 SASI_Mm02_00300606 predicted 632
6 SASI_Mm02_00300607 predicted 636
7 SASI_Mm02_00300608 predicted 392
8 SASI_Mm02_00300609 predicted 496
9 SASI_Mm02_00300610 predicted 384
10 SASI_Mm02_00300611 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_112246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258400 predicted 413
2 SASI_Mm01_00258401 predicted 608
3 SASI_Mm01_00258402 predicted 343
4 SASI_Mm01_00258403 predicted 338
5 SASI_Mm01_00258404 predicted 386
6 SASI_Mm01_00258405 predicted 584
7 SASI_Mm01_00258406 predicted 580
8 SASI_Mm01_00258407 predicted 232
9 SASI_Mm01_00258408 predicted 626
10 SASI_Mm01_00258409 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032526
NT5C1A MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase, cytosolic IA
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-247s1c1
Sequence:CCGGCAGCTGGAACATGAGAACGAACTCGAGTTCGTTCTCATGTTCCAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-423s1c1
Sequence:CCGGCAACCACTATGACCTGTTCATCTCGAGATGAACAGGTCATAGTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-693s1c1
Sequence:CCGGCCGATTCTTCGAGCATGAGAACTCGAGTTCTCATGCTCGAAGAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-816s1c1
Sequence:CCGGGTGCCCAATTCGTACCTACTTCTCGAGAAGTAGGTACGAATTGGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-77s1c1
Sequence:CCGGTCTGGGAGGAAGCCAAGATTTCTCGAGAAATCTTGGCTTCCTCCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-366s21c1
Sequence:CCGGCATCGTCCTCATGACTAACAACTCGAGTTGTTAGTCATGAGGACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-535s21c1
Sequence:CCGGGTGCGAGAAGCCATTGATGAGCTCGAGCTCATCAATGGCTTCTCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-481s21c1
Sequence:CCGGTGCTACCTCAAGGCCTATCACCTCGAGGTGATAGGCCTTGAGGTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-113s21c1
Sequence:CCGGCGCCCAAGAAGAAACCCAAATCTCGAGATTTGGGTTTCTTCTTGGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032526
NT5C1A MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase, cytosolic IA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-247s1c1
Sequence:CCGGCAGCTGGAACATGAGAACGAACTCGAGTTCGTTCTCATGTTCCAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-423s1c1
Sequence:CCGGCAACCACTATGACCTGTTCATCTCGAGATGAACAGGTCATAGTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-693s1c1
Sequence:CCGGCCGATTCTTCGAGCATGAGAACTCGAGTTCTCATGCTCGAAGAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-816s1c1
Sequence:CCGGGTGCCCAATTCGTACCTACTTCTCGAGAAGTAGGTACGAATTGGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-77s1c1
Sequence:CCGGTCTGGGAGGAAGCCAAGATTTCTCGAGAAATCTTGGCTTCCTCCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-366s21c1
Sequence:CCGGCATCGTCCTCATGACTAACAACTCGAGTTGTTAGTCATGAGGACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-535s21c1
Sequence:CCGGGTGCGAGAAGCCATTGATGAGCTCGAGCTCATCAATGGCTTCTCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-481s21c1
Sequence:CCGGTGCTACCTCAAGGCCTATCACCTCGAGGTGATAGGCCTTGAGGTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-113s21c1
Sequence:CCGGCGCCCAAGAAGAAACCCAAATCTCGAGATTTGGGTTTCTTCTTGGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032526
NT5C1A MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase, cytosolic IA
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-247s1c1
Sequence:CCGGCAGCTGGAACATGAGAACGAACTCGAGTTCGTTCTCATGTTCCAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-423s1c1
Sequence:CCGGCAACCACTATGACCTGTTCATCTCGAGATGAACAGGTCATAGTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-693s1c1
Sequence:CCGGCCGATTCTTCGAGCATGAGAACTCGAGTTCTCATGCTCGAAGAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-816s1c1
Sequence:CCGGGTGCCCAATTCGTACCTACTTCTCGAGAAGTAGGTACGAATTGGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032526.1-77s1c1
Sequence:CCGGTCTGGGAGGAAGCCAAGATTTCTCGAGAAATCTTGGCTTCCTCCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-366s21c1
Sequence:CCGGCATCGTCCTCATGACTAACAACTCGAGTTGTTAGTCATGAGGACGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-535s21c1
Sequence:CCGGGTGCGAGAAGCCATTGATGAGCTCGAGCTCATCAATGGCTTCTCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-481s21c1
Sequence:CCGGTGCTACCTCAAGGCCTATCACCTCGAGGTGATAGGCCTTGAGGTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032526.1-113s21c1
Sequence:CCGGCGCCCAAGAAGAAACCCAAATCTCGAGATTTGGGTTTCTTCTTGGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085502
NT5C1A MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase, cytosolic IA
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-812s21c1
Sequence:CCGGGTGCCCGATTCGCACGTATTTCTCGAGAAATACGTGCGAATCGGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-409s21c1
Sequence:CCGGTCAACAGTATCAACCATTATGCTCGAGCATAATGGTTGATACTGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-899s21c1
Sequence:CCGGGGAGACGGATGAGGCCTTATTCTCGAGAATAAGGCCTCATCCGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-335s21c1
Sequence:CCGGGTACCCTGATAGCGAAGATATCTCGAGATATCTTCGCTATCAGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-679s21c1
Sequence:CCGGATGGGCTGGACAGATTCTTTGCTCGAGCAAAGAATCTGTCCAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085502
NT5C1A MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase, cytosolic IA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-812s21c1
Sequence:CCGGGTGCCCGATTCGCACGTATTTCTCGAGAAATACGTGCGAATCGGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-409s21c1
Sequence:CCGGTCAACAGTATCAACCATTATGCTCGAGCATAATGGTTGATACTGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-899s21c1
Sequence:CCGGGGAGACGGATGAGGCCTTATTCTCGAGAATAAGGCCTCATCCGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-335s21c1
Sequence:CCGGGTACCCTGATAGCGAAGATATCTCGAGATATCTTCGCTATCAGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-679s21c1
Sequence:CCGGATGGGCTGGACAGATTCTTTGCTCGAGCAAAGAATCTGTCCAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085502
NT5C1A MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase, cytosolic IA
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-812s21c1
Sequence:CCGGGTGCCCGATTCGCACGTATTTCTCGAGAAATACGTGCGAATCGGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-409s21c1
Sequence:CCGGTCAACAGTATCAACCATTATGCTCGAGCATAATGGTTGATACTGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-899s21c1
Sequence:CCGGGGAGACGGATGAGGCCTTATTCTCGAGAATAAGGCCTCATCCGTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-335s21c1
Sequence:CCGGGTACCCTGATAGCGAAGATATCTCGAGATATCTTCGCTATCAGGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085502.1-679s21c1
Sequence:CCGGATGGGCTGGACAGATTCTTTGCTCGAGCAAAGAATCTGTCCAGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)