EMAIL THIS PAGE TO A FRIEND

NT5C2

5'-nucleotidase, cytosolic II

66 Gene Product Result for
Synonyms: GMP NT5B PNT5 cN-II
UniProtKB ID: P49902, D3DR91, Q5JUV5
Gene ID:
Human(22978) Summary: This gene encodes a hydrolase that serves as an important role in cellular purine metabolism by acting primarily on inosine 5'-monophosphate and other purine nucleotides. [provided by RefSeq, Oct 2011]
Mouse(76952) 5'-nucleotidase, cytosolic II
Rat(294016) 5'-nucleotidase, cytosolic II
chicken(423871) 5'-nucleotidase, cytosolic II
Horse(100069793) 5'-nucleotidase, cytosolic II
cow(281951) 5'-nucleotidase, cytosolic II
domestic cat(101083622) 5'-nucleotidase, cytosolic II
dog(477809) 5'-nucleotidase, cytosolic II
domestic guinea pig(100727140) 5'-nucleotidase, cytosolic II
naked mole-rat(101701244) 5'-nucleotidase, cytosolic II
Domestic Rabbit(100347769) 5'-nucleotidase, cytosolic II
sheep(101110104) 5'-nucleotidase, cytosolic II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012229 Rosetta Predictions human pricing
XM_215270 Rosetta Predictions rat pricing
NM_029810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011246 predicted 861
2 SASI_Hs02_00343909 predicted 839
3 SASI_Hs01_00011247 predicted 535
4 SASI_Hs01_00011248 predicted 435
5 SASI_Hs02_00343910 predicted 1038
6 SASI_Hs01_00011249 predicted 354
7 SASI_Hs01_00011250 predicted 670
8 SASI_Hs01_00011251 predicted 979
9 SASI_Hs01_00011253 predicted 1389
10 SASI_Hs01_00011254 predicted 719
11 SASI_Hs01_00011252 predicted 901
12 SASI_Hs01_00011255 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180204 predicted 326
2 SASI_Rn01_00180205 predicted 1692
3 SASI_Rn01_00180206 predicted 278
4 SASI_Rn01_00180207 predicted 328
5 SASI_Rn01_00180208 predicted 644
6 SASI_Rn01_00180209 predicted 812
7 SASI_Rn01_00180210 predicted 811
8 SASI_Rn01_00180211 predicted 318
9 SASI_Rn01_00180212 predicted 1598
10 SASI_Rn01_00180213 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133873 predicted 791
2 SASI_Mm01_00133874 predicted 1278
3 SASI_Mm01_00133875 predicted 451
4 SASI_Mm01_00133876 predicted 480
5 SASI_Mm01_00133877 predicted 799
6 SASI_Mm01_00133878 predicted 516
7 SASI_Mm01_00133879 predicted 1601
8 SASI_Mm01_00133880 predicted 268
9 SASI_Mm01_00133881 predicted 1429
10 SASI_Mm01_00133882 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012229
VALIDATED
NT5C2 MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase, cytosolic II
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-535s1c1
Sequence:CCGGCCAGAAACTAGAGAACAGTATCTCGAGATACTGTTCTCTAGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-727s1c1
Sequence:CCGGCGGAGTATGTTCCAGGATGTACTCGAGTACATCCTGGAACATACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-671s1c1
Sequence:CCGGCCAGATATACCAGTTGTGAAACTCGAGTTTCACAACTGGTATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-190s1c1
Sequence:CCGGCCTGCTAACATGGATAAGCATCTCGAGATGCTTATCCATGTTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-1720s1c1
Sequence:CCGGCGGTCAATTAGTGAGATTAAACTCGAGTTTAATCTCACTAATTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-2240s21c1
Sequence:CCGGGTGATCTGTAATGTTACAAATCTCGAGATTTGTAACATTACAGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-928s21c1
Sequence:CCGGGCTACCAACAGTGACTATAAACTCGAGTTTATAGTCACTGTTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-577s21c1
Sequence:CCGGCCAGAAACTAGAGAACAGTATCTCGAGATACTGTTCTCTAGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-713s21c1
Sequence:CCGGCCAGATATACCAGTTGTGAAACTCGAGTTTCACAACTGGTATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-1762s21c1
Sequence:CCGGCGGTCAATTAGTGAGATTAAACTCGAGTTTAATCTCACTAATTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012229
VALIDATED
NT5C2 MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase, cytosolic II
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-535s1c1
Sequence:CCGGCCAGAAACTAGAGAACAGTATCTCGAGATACTGTTCTCTAGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-727s1c1
Sequence:CCGGCGGAGTATGTTCCAGGATGTACTCGAGTACATCCTGGAACATACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-671s1c1
Sequence:CCGGCCAGATATACCAGTTGTGAAACTCGAGTTTCACAACTGGTATATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-190s1c1
Sequence:CCGGCCTGCTAACATGGATAAGCATCTCGAGATGCTTATCCATGTTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-1720s1c1
Sequence:CCGGCGGTCAATTAGTGAGATTAAACTCGAGTTTAATCTCACTAATTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-2240s21c1
Sequence:CCGGGTGATCTGTAATGTTACAAATCTCGAGATTTGTAACATTACAGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-928s21c1
Sequence:CCGGGCTACCAACAGTGACTATAAACTCGAGTTTATAGTCACTGTTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-577s21c1
Sequence:CCGGCCAGAAACTAGAGAACAGTATCTCGAGATACTGTTCTCTAGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-713s21c1
Sequence:CCGGCCAGATATACCAGTTGTGAAACTCGAGTTTCACAACTGGTATATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-1762s21c1
Sequence:CCGGCGGTCAATTAGTGAGATTAAACTCGAGTTTAATCTCACTAATTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012229
VALIDATED
NT5C2 MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase, cytosolic II
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-535s1c1
Sequence:CCGGCCAGAAACTAGAGAACAGTATCTCGAGATACTGTTCTCTAGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-727s1c1
Sequence:CCGGCGGAGTATGTTCCAGGATGTACTCGAGTACATCCTGGAACATACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-671s1c1
Sequence:CCGGCCAGATATACCAGTTGTGAAACTCGAGTTTCACAACTGGTATATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-190s1c1
Sequence:CCGGCCTGCTAACATGGATAAGCATCTCGAGATGCTTATCCATGTTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012229.2-1720s1c1
Sequence:CCGGCGGTCAATTAGTGAGATTAAACTCGAGTTTAATCTCACTAATTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-2240s21c1
Sequence:CCGGGTGATCTGTAATGTTACAAATCTCGAGATTTGTAACATTACAGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-928s21c1
Sequence:CCGGGCTACCAACAGTGACTATAAACTCGAGTTTATAGTCACTGTTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-577s21c1
Sequence:CCGGCCAGAAACTAGAGAACAGTATCTCGAGATACTGTTCTCTAGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-713s21c1
Sequence:CCGGCCAGATATACCAGTTGTGAAACTCGAGTTTCACAACTGGTATATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_012229.3-1762s21c1
Sequence:CCGGCGGTCAATTAGTGAGATTAAACTCGAGTTTAATCTCACTAATTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029810
VALIDATED
NT5C2 MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase, cytosolic II
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-895s1c1
Sequence:CCGGCAGTCCTACTTTGACCTGATTCTCGAGAATCAGGTCAAAGTAGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029810.2-1848s1c1
Sequence:CCGGCCTGGAAAGTTTGGAAAGTTTCTCGAGAAACTTTCCAAACTTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-894s1c1
Sequence:CCGGGCAGTCCTACTTTGACCTGATCTCGAGATCAGGTCAAAGTAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-1321s1c1
Sequence:CCGGCGGATTAAGAAAGTAACTCATCTCGAGATGAGTTACTTTCTTAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-1582s1c1
Sequence:CCGGCGCACGTCAGTGGATTTCAAACTCGAGTTTGAAATCCACTGACGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-1320s21c1
Sequence:CCGGCGGATTAAGAAAGTAACTCATCTCGAGATGAGTTACTTTCTTAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-894s21c1
Sequence:CCGGCAGTCCTACTTTGACCTGATTCTCGAGAATCAGGTCAAAGTAGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-1581s21c1
Sequence:CCGGCGCACGTCAGTGGATTTCAAACTCGAGTTTGAAATCCACTGACGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-798s21c1
Sequence:CCGGGCTACTAACAGTGACTATAAGCTCGAGCTTATAGTCACTGTTAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029810.3-1847s21c1
Sequence:CCGGCCTGGAAAGTTTGGAAAGTTTCTCGAGAAACTTTCCAAACTTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029810
VALIDATED
NT5C2 MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase, cytosolic II
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-895s1c1
Sequence:CCGGCAGTCCTACTTTGACCTGATTCTCGAGAATCAGGTCAAAGTAGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029810.2-1848s1c1
Sequence:CCGGCCTGGAAAGTTTGGAAAGTTTCTCGAGAAACTTTCCAAACTTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-894s1c1
Sequence:CCGGGCAGTCCTACTTTGACCTGATCTCGAGATCAGGTCAAAGTAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-1321s1c1
Sequence:CCGGCGGATTAAGAAAGTAACTCATCTCGAGATGAGTTACTTTCTTAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-1582s1c1
Sequence:CCGGCGCACGTCAGTGGATTTCAAACTCGAGTTTGAAATCCACTGACGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-1320s21c1
Sequence:CCGGCGGATTAAGAAAGTAACTCATCTCGAGATGAGTTACTTTCTTAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-894s21c1
Sequence:CCGGCAGTCCTACTTTGACCTGATTCTCGAGAATCAGGTCAAAGTAGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-1581s21c1
Sequence:CCGGCGCACGTCAGTGGATTTCAAACTCGAGTTTGAAATCCACTGACGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-798s21c1
Sequence:CCGGGCTACTAACAGTGACTATAAGCTCGAGCTTATAGTCACTGTTAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029810.3-1847s21c1
Sequence:CCGGCCTGGAAAGTTTGGAAAGTTTCTCGAGAAACTTTCCAAACTTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029810
VALIDATED
NT5C2 MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase, cytosolic II
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-895s1c1
Sequence:CCGGCAGTCCTACTTTGACCTGATTCTCGAGAATCAGGTCAAAGTAGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029810.2-1848s1c1
Sequence:CCGGCCTGGAAAGTTTGGAAAGTTTCTCGAGAAACTTTCCAAACTTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-894s1c1
Sequence:CCGGGCAGTCCTACTTTGACCTGATCTCGAGATCAGGTCAAAGTAGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-1321s1c1
Sequence:CCGGCGGATTAAGAAAGTAACTCATCTCGAGATGAGTTACTTTCTTAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029810.2-1582s1c1
Sequence:CCGGCGCACGTCAGTGGATTTCAAACTCGAGTTTGAAATCCACTGACGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-1320s21c1
Sequence:CCGGCGGATTAAGAAAGTAACTCATCTCGAGATGAGTTACTTTCTTAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-894s21c1
Sequence:CCGGCAGTCCTACTTTGACCTGATTCTCGAGAATCAGGTCAAAGTAGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-1581s21c1
Sequence:CCGGCGCACGTCAGTGGATTTCAAACTCGAGTTTGAAATCCACTGACGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029810.3-798s21c1
Sequence:CCGGGCTACTAACAGTGACTATAAGCTCGAGCTTATAGTCACTGTTAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029810.3-1847s21c1
Sequence:CCGGCCTGGAAAGTTTGGAAAGTTTCTCGAGAAACTTTCCAAACTTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)