EMAIL THIS PAGE TO A FRIEND

NT5C3A

5'-nucleotidase, cytosolic IIIA

68 Gene Product Result for
Synonyms: NT5C3 P5'N-1 P5N-1 PN-I POMP PSN1 UMPH UMPH1 cN-III hUMP1 p36
Gene ID:
Human(51251) Summary: This gene encodes a member of the 5'-nucleotidase family of enzymes that catalyze the dephosphorylation of nucleoside 5'-monophosphates. The encoded protein is the type 1 isozyme of pyrimidine 5' nucleotidase and catalyzes the dephosphorylation of pyrimidine 5' monophosphates. Mutations in this gene are a cause of hemolytic anemia due to uridine 5-prime monophosphate hydrolase deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and pseudogenes of this gene are located on the long arm of chromosomes 3 and 4. [provided by RefSeq, Mar 2012]
Rat(312373) 5'-nucleotidase, cytosolic IIIA
naked mole-rat(101716631) 5'-nucleotidase, cytosolic IIIA
domestic guinea pig(100721153) 5'-nucleotidase, cytosolic IIIA
Zebrafish(321720) 5'-nucleotidase, cytosolic IIIA
chicken(395080) 5'-nucleotidase, cytosolic III
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016489 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108121 MISSION® esiRNA esiRNA human NT5C3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002009 Rosetta Predictions human pricing
NM_001002010 Rosetta Predictions human pricing
NM_016489 Rosetta Predictions human pricing
NM_001107862 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119257 predicted 525
2 SASI_Hs01_00119259 predicted 799
3 SASI_Hs02_00304070 predicted 652
4 SASI_Hs01_00119261 predicted 738
5 SASI_Hs01_00119262 predicted 846
6 SASI_Hs01_00119263 predicted 563
7 SASI_Hs01_00119264 predicted 1103
8 SASI_Hs01_00119265 predicted 775
9 SASI_Hs02_00304071 predicted 756
10 SASI_Hs01_00119266 predicted 991
11 SASI_Hs01_00119258 predicted 907
12 SASI_Hs01_00119260 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205411 predicted 476
2 SASI_Hs01_00205413 predicted 741
3 SASI_Hs02_00304072 predicted 593
4 SASI_Hs01_00205415 predicted 684
5 SASI_Hs01_00205416 predicted 790
6 SASI_Hs01_00205417 predicted 516
7 SASI_Hs01_00205418 predicted 1043
8 SASI_Hs01_00205419 predicted 721
9 SASI_Hs02_00304073 predicted 702
10 SASI_Hs01_00205420 predicted 940
11 SASI_Hs01_00205412 predicted 852
12 SASI_Hs01_00205414 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065925 predicted 343
2 SASI_Hs01_00065927 predicted 604
3 SASI_Hs02_00349548 predicted 463
4 SASI_Hs01_00065929 predicted 551
5 SASI_Hs01_00065930 predicted 654
6 SASI_Hs01_00065931 predicted 374
7 SASI_Hs01_00065932 predicted 907
8 SASI_Hs01_00065933 predicted 590
9 SASI_Hs02_00349549 predicted 566
10 SASI_Hs01_00065934 predicted 797
11 SASI_Hs01_00065926 predicted 724
12 SASI_Hs01_00065928 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233015 predicted 515
2 SASI_Rn02_00233016 predicted 494
3 SASI_Rn02_00233017 predicted 987
4 SASI_Rn02_00233018 predicted 783
5 SASI_Rn02_00233019 predicted 440
6 SASI_Rn02_00233020 predicted 712
7 SASI_Rn02_00233021 predicted 362
8 SASI_Rn02_00233022 predicted 490
9 SASI_Rn02_00233023 predicted 822
10 SASI_Rn02_00233024 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016489
NT5C3A MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase, cytosolic IIIA
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-561s1c1
Sequence:CCGGGCGATGTACTAGAGGAAGTTACTCGAGTAACTTCCTCTAGTACATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-707s1c1
Sequence:CCGGGCCTTGAGGAATACAGAATATCTCGAGATATTCTGTATTCCTCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-912s1c1
Sequence:CCGGCATTAGAAGTAGCCAACTCTACTCGAGTAGAGTTGGCTACTTCTAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-590s1c1
Sequence:CCGGGCTGGTGTTTATCATCCCAATCTCGAGATTGGGATGATAAACACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-134s1c1
Sequence:CCGGCCTACAAGAGTAGAAGAAATTCTCGAGAATTTCTTCTACTCTTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016489.11-386s21c1
Sequence:CCGGATGGTGGAATGGTATACTAAACTCGAGTTTAGTATACCATTCCACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016489.11-209s21c1
Sequence:CCGGGATATGACACTCAGTAGATTTCTCGAGAAATCTACTGAGTGTCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016489
NT5C3A MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase, cytosolic IIIA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-561s1c1
Sequence:CCGGGCGATGTACTAGAGGAAGTTACTCGAGTAACTTCCTCTAGTACATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-707s1c1
Sequence:CCGGGCCTTGAGGAATACAGAATATCTCGAGATATTCTGTATTCCTCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-912s1c1
Sequence:CCGGCATTAGAAGTAGCCAACTCTACTCGAGTAGAGTTGGCTACTTCTAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-590s1c1
Sequence:CCGGGCTGGTGTTTATCATCCCAATCTCGAGATTGGGATGATAAACACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-134s1c1
Sequence:CCGGCCTACAAGAGTAGAAGAAATTCTCGAGAATTTCTTCTACTCTTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016489.11-386s21c1
Sequence:CCGGATGGTGGAATGGTATACTAAACTCGAGTTTAGTATACCATTCCACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016489.11-209s21c1
Sequence:CCGGGATATGACACTCAGTAGATTTCTCGAGAAATCTACTGAGTGTCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016489
NT5C3A MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase, cytosolic IIIA
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-561s1c1
Sequence:CCGGGCGATGTACTAGAGGAAGTTACTCGAGTAACTTCCTCTAGTACATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-707s1c1
Sequence:CCGGGCCTTGAGGAATACAGAATATCTCGAGATATTCTGTATTCCTCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-912s1c1
Sequence:CCGGCATTAGAAGTAGCCAACTCTACTCGAGTAGAGTTGGCTACTTCTAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-590s1c1
Sequence:CCGGGCTGGTGTTTATCATCCCAATCTCGAGATTGGGATGATAAACACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016489.10-134s1c1
Sequence:CCGGCCTACAAGAGTAGAAGAAATTCTCGAGAATTTCTTCTACTCTTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016489.11-386s21c1
Sequence:CCGGATGGTGGAATGGTATACTAAACTCGAGTTTAGTATACCATTCCACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016489.11-209s21c1
Sequence:CCGGGATATGACACTCAGTAGATTTCTCGAGAAATCTACTGAGTGTCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)