EMAIL THIS PAGE TO A FRIEND

NT5DC1

5'-nucleotidase domain containing 1

144 Gene Product Result for
Synonyms: C6orf200 LP2642 NT5C2L1
UniProtKB ID: Q5TFE4, B2RND9, Q6XYD5
Gene ID:
Human(221294) Summary: While the exact function of the protein encoded by this gene is not known, it belongs to the 5'(3')-deoxyribonucleotidase family. [provided by RefSeq, May 2010]
Mouse(319638) 5'-nucleotidase domain containing 1
Rat(294456) 5'-nucleotidase domain containing 1
Zebrafish(568757) 5'-nucleotidase domain containing 1
cow(100125914) 5'-nucleotidase domain containing 1
Horse(100072637) 5'-nucleotidase domain containing 1
domestic cat(101088932) 5'-nucleotidase domain containing 1
dog(475036) 5'-nucleotidase domain containing 1
chicken(421746) 5'-nucleotidase domain containing 1
sheep(101106437) 5'-nucleotidase domain containing 1
naked mole-rat(101709262) 5'-nucleotidase domain containing 1
domestic guinea pig(100714559) 5'-nucleotidase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152729 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160341 MISSION® esiRNA esiRNA human NT5DC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152729 Rosetta Predictions human pricing
NM_001106393 Rosetta Predictions rat pricing
XM_215405 Rosetta Predictions rat pricing
NM_176968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076552 predicted 872
2 SASI_Hs02_00366635 predicted 423
3 SASI_Hs01_00076553 predicted 763
4 SASI_Hs02_00366636 predicted 268
5 SASI_Hs01_00076554 predicted 322
6 SASI_Hs01_00076555 predicted 781
7 SASI_Hs01_00076556 predicted 760
8 SASI_Hs02_00366637 predicted 849
9 SASI_Hs01_00076557 predicted 566
10 SASI_Hs01_00076558 predicted 1055
11 SASI_Hs01_00076559 predicted 720
12 SASI_Hs01_00076560 predicted 863
13 SASI_Hs01_00076561 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218518 predicted 802
2 SASI_Rn02_00218519 predicted 772
3 SASI_Rn02_00218520 predicted 1288
4 SASI_Rn02_00218521 predicted 1323
5 SASI_Rn02_00218522 predicted 1418
6 SASI_Rn02_00218523 predicted 900
7 SASI_Rn02_00218524 predicted 792
8 SASI_Rn02_00218525 predicted 1299
9 SASI_Rn02_00218526 predicted 1497
10 SASI_Rn02_00218527 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173557 predicted 1165
2 SASI_Rn01_00173558 predicted 1636
3 SASI_Rn01_00173559 predicted 1070
4 SASI_Rn01_00173560 predicted 1719
5 SASI_Rn01_00173561 predicted 1663
6 SASI_Rn01_00173562 predicted 1045
7 SASI_Rn01_00173563 predicted 1298
8 SASI_Rn01_00173564 predicted 1190
9 SASI_Rn01_00173565 predicted 1701
10 SASI_Rn01_00173566 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346882 predicted 1286
2 SASI_Mm01_00118422 predicted 756
3 SASI_Mm01_00118423 predicted 278
4 SASI_Mm01_00118424 predicted 889
5 SASI_Mm01_00118425 predicted 1020
6 SASI_Mm01_00118426 predicted 1253
7 SASI_Mm01_00118427 predicted 774
8 SASI_Mm01_00118428 predicted 1197
9 SASI_Mm01_00118429 predicted 1401
10 SASI_Mm01_00118430 predicted 1266
11 SASI_Mm01_00118431 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152729
VALIDATED
NT5DC1 MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-2774s1c1
Sequence:CCGGCCTGGATTGAAGTGCAGAATTCTCGAGAATTCTGCACTTCAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-849s1c1
Sequence:CCGGCCTGGTTTCTTCTCCCACTTACTCGAGTAAGTGGGAGAAGAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-185s1c1
Sequence:CCGGCCCGCTCATTTATAATAGCTTCTCGAGAAGCTATTATAAATGAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-1343s1c1
Sequence:CCGGCGCAGAATTACCTCTGGACTACTCGAGTAGTCCAGAGGTAATTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-452s1c1
Sequence:CCGGCCGCTCAGGAAAGTATTACTTCTCGAGAAGTAATACTTTCCTGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152729.2-849s21c1
Sequence:CCGGCCTGGTTTCTTCTCCCACTTACTCGAGTAAGTGGGAGAAGAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152729.2-452s21c1
Sequence:CCGGCCGCTCAGGAAAGTATTACTTCTCGAGAAGTAATACTTTCCTGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152729.2-185s21c1
Sequence:CCGGCCCGCTCATTTATAATAGCTTCTCGAGAAGCTATTATAAATGAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_152729.2-1343s21c1
Sequence:CCGGCGCAGAATTACCTCTGGACTACTCGAGTAGTCCAGAGGTAATTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152729
VALIDATED
NT5DC1 MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-2774s1c1
Sequence:CCGGCCTGGATTGAAGTGCAGAATTCTCGAGAATTCTGCACTTCAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-849s1c1
Sequence:CCGGCCTGGTTTCTTCTCCCACTTACTCGAGTAAGTGGGAGAAGAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-185s1c1
Sequence:CCGGCCCGCTCATTTATAATAGCTTCTCGAGAAGCTATTATAAATGAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-1343s1c1
Sequence:CCGGCGCAGAATTACCTCTGGACTACTCGAGTAGTCCAGAGGTAATTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-452s1c1
Sequence:CCGGCCGCTCAGGAAAGTATTACTTCTCGAGAAGTAATACTTTCCTGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152729.2-849s21c1
Sequence:CCGGCCTGGTTTCTTCTCCCACTTACTCGAGTAAGTGGGAGAAGAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152729.2-452s21c1
Sequence:CCGGCCGCTCAGGAAAGTATTACTTCTCGAGAAGTAATACTTTCCTGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152729.2-185s21c1
Sequence:CCGGCCCGCTCATTTATAATAGCTTCTCGAGAAGCTATTATAAATGAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_152729.2-1343s21c1
Sequence:CCGGCGCAGAATTACCTCTGGACTACTCGAGTAGTCCAGAGGTAATTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152729
VALIDATED
NT5DC1 MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-2774s1c1
Sequence:CCGGCCTGGATTGAAGTGCAGAATTCTCGAGAATTCTGCACTTCAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-849s1c1
Sequence:CCGGCCTGGTTTCTTCTCCCACTTACTCGAGTAAGTGGGAGAAGAAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-185s1c1
Sequence:CCGGCCCGCTCATTTATAATAGCTTCTCGAGAAGCTATTATAAATGAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-1343s1c1
Sequence:CCGGCGCAGAATTACCTCTGGACTACTCGAGTAGTCCAGAGGTAATTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152729.2-452s1c1
Sequence:CCGGCCGCTCAGGAAAGTATTACTTCTCGAGAAGTAATACTTTCCTGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152729.2-849s21c1
Sequence:CCGGCCTGGTTTCTTCTCCCACTTACTCGAGTAAGTGGGAGAAGAAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152729.2-452s21c1
Sequence:CCGGCCGCTCAGGAAAGTATTACTTCTCGAGAAGTAATACTTTCCTGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152729.2-185s21c1
Sequence:CCGGCCCGCTCATTTATAATAGCTTCTCGAGAAGCTATTATAAATGAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_152729.2-1343s21c1
Sequence:CCGGCGCAGAATTACCTCTGGACTACTCGAGTAGTCCAGAGGTAATTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176968
NT5DC1 MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-466s1c1
Sequence:CCGGCTCAGGAAAGTGTTATTTCTACTCGAGTAGAAATAACACTTTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-859s1c1
Sequence:CCGGGCCTGGATTCTTCTCACATTTCTCGAGAAATGTGAGAAGAATCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176968.2-1907s1c1
Sequence:CCGGCCAGTAAATCGAATGCTCTATCTCGAGATAGAGCATTCGATTTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-191s1c1
Sequence:CCGGCAGTTCTTAGTCAAGGAGAAACTCGAGTTTCTCCTTGACTAAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176968.2-2186s1c1
Sequence:CCGGGCTGGAAGACACAGTTGCTTACTCGAGTAAGCAACTGTGTCTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-1305s1c1
Sequence:CCGGGCACCTACAGTACGATTGCAACTCGAGTTGCAATCGTACTGTAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.4-644s1c1
Sequence:CCGGGATTCTTCTTTCCGGAAATAACTCGAGTTATTTCCGGAAAGAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176968
NT5DC1 MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-466s1c1
Sequence:CCGGCTCAGGAAAGTGTTATTTCTACTCGAGTAGAAATAACACTTTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-859s1c1
Sequence:CCGGGCCTGGATTCTTCTCACATTTCTCGAGAAATGTGAGAAGAATCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176968.2-1907s1c1
Sequence:CCGGCCAGTAAATCGAATGCTCTATCTCGAGATAGAGCATTCGATTTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-191s1c1
Sequence:CCGGCAGTTCTTAGTCAAGGAGAAACTCGAGTTTCTCCTTGACTAAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176968.2-2186s1c1
Sequence:CCGGGCTGGAAGACACAGTTGCTTACTCGAGTAAGCAACTGTGTCTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-1305s1c1
Sequence:CCGGGCACCTACAGTACGATTGCAACTCGAGTTGCAATCGTACTGTAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.4-644s1c1
Sequence:CCGGGATTCTTCTTTCCGGAAATAACTCGAGTTATTTCCGGAAAGAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176968
NT5DC1 MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-466s1c1
Sequence:CCGGCTCAGGAAAGTGTTATTTCTACTCGAGTAGAAATAACACTTTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-859s1c1
Sequence:CCGGGCCTGGATTCTTCTCACATTTCTCGAGAAATGTGAGAAGAATCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176968.2-1907s1c1
Sequence:CCGGCCAGTAAATCGAATGCTCTATCTCGAGATAGAGCATTCGATTTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-191s1c1
Sequence:CCGGCAGTTCTTAGTCAAGGAGAAACTCGAGTTTCTCCTTGACTAAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176968.2-2186s1c1
Sequence:CCGGGCTGGAAGACACAGTTGCTTACTCGAGTAAGCAACTGTGTCTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.2-1305s1c1
Sequence:CCGGGCACCTACAGTACGATTGCAACTCGAGTTGCAATCGTACTGTAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176968.4-644s1c1
Sequence:CCGGGATTCTTCTTTCCGGAAATAACTCGAGTTATTTCCGGAAAGAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)