EMAIL THIS PAGE TO A FRIEND

NT5E

5'-nucleotidase, ecto (CD73)

64 Gene Product Result for
Synonyms: CALJA CD73 E5NT NT NT5 NTE eN eNT
UniProtKB ID: P21589, B3KQI8, O75520, Q5W116
Gene ID:
Human(4907) Summary: The protein encoded by this gene is a plasma membrane protein that catalyzes the conversion of extracellular nucleotides to membrane-permeable nucleosides. The encoded protein is used as a determinant of lymphocyte differentiation. Defects in this gene can lead to the calcification of joints and arteries. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
Mouse(23959) 5' nucleotidase, ecto
Rat(58813) 5' nucleotidase, ecto
Zebrafish(393906) 5'-nucleotidase, ecto (CD73)
chicken(421833) 5'-nucleotidase, ecto (CD73)
dog(474984) 5'-nucleotidase, ecto (CD73)
cow(281363) 5'-nucleotidase, ecto (CD73)
Horse(100070458) 5'-nucleotidase, ecto (CD73)
domestic cat(101087744) 5'-nucleotidase, ecto (CD73)
sheep(101116406) 5'-nucleotidase, ecto (CD73)
naked mole-rat(101707419) 5'-nucleotidase, ecto (CD73)
Domestic Rabbit(100356979) 5'-nucleotidase, ecto (CD73)
domestic guinea pig(100725593) 5'-nucleotidase, ecto (CD73)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023471 MISSION® esiRNA esiRNA human NT5E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002526 Rosetta Predictions human pricing
NM_021576 Rosetta Predictions rat pricing
NM_011851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209686 predicted 1808
2 SASI_Hs01_00209688 predicted 1907
3 SASI_Hs01_00209689 predicted 1587
4 SASI_Hs01_00209690 predicted 1413
5 SASI_Hs01_00209691 predicted 2169
6 SASI_Hs01_00209692 predicted 2116
7 SASI_Hs01_00209693 predicted 813
8 SASI_Hs02_00334002 predicted 1489
9 SASI_Hs01_00209694 predicted 1786
10 SASI_Hs02_00334003 predicted 894
11 SASI_Hs01_00209687 predicted 1222
12 SASI_Hs01_00209695 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262593 predicted 446
2 SASI_Rn02_00262594 predicted 699
3 SASI_Rn02_00262595 predicted 1002
4 SASI_Rn02_00262596 predicted 602
5 SASI_Rn02_00262597 predicted 1291
6 SASI_Rn02_00262598 predicted 1493
7 SASI_Rn02_00262599 predicted 1706
8 SASI_Rn02_00262600 predicted 248
9 SASI_Rn02_00262601 predicted 1404
10 SASI_Rn02_00262602 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073922 predicted 641
2 SASI_Mm01_00073923 predicted 1306
3 SASI_Mm01_00073924 predicted 340
4 SASI_Mm01_00073925 predicted 1723
5 SASI_Mm01_00073927 predicted 1714
6 SASI_Mm01_00073928 predicted 1491
7 SASI_Mm01_00073929 predicted 957
8 SASI_Mm01_00073930 predicted 1682
9 SASI_Mm01_00073931 predicted 1020
10 SASI_Mm02_00321596 predicted 1443
11 SASI_Mm01_00073926 predicted 941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002526
VALIDATED
NT5E MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase, ecto (CD73)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-2514s21c1
Sequence:CCGGTAAGTTTACGTGTCCAAATTTCTCGAGAAATTTGGACACGTAAACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002526.2-1745s21c1
Sequence:CCGGCCCATTGATGAACGCAACAATCTCGAGATTGTTGCGTTCATCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002526.2-896s21c1
Sequence:CCGGGCACTGGGAAATCATGAATTTCTCGAGAAATTCATGATTTCCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-2476s21c1
Sequence:CCGGATTAACATAGGGCCCTATAAGCTCGAGCTTATAGGGCCCTATGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-1989s21c1
Sequence:CCGGAGTGTCGAGTGCCCAGTTATGCTCGAGCATAACTGGGCACTCGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-1644s21c1
Sequence:CCGGTGATTTGTGATGCAATGATTACTCGAGTAATCATTGCATCACAAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-1419s21c1
Sequence:CCGGGCTATCTGAAGATCGAGTTTGCTCGAGCAAACTCGATCTTCAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-1238s1c1
Sequence:CCGGCCCATTGATGAACGCAACAATCTCGAGATTGTTGCGTTCATCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-1493s1c1
Sequence:CCGGCCCAGTTATGACCCTCTCAAACTCGAGTTTGAGAGGGTCATAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-1095s1c1
Sequence:CCGGCCTCTCAATCATGCCGCTTTACTCGAGTAAAGCGGCATGATTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-389s1c1
Sequence:CCGGGCACTGGGAAATCATGAATTTCTCGAGAAATTCATGATTTCCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002526.1-513s1c1
Sequence:CCGGCAGGACTTTATTTGCCATATACTCGAGTATATGGCAAATAAAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002526
VALIDATED
NT5E MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase, ecto (CD73)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-2514s21c1
Sequence:CCGGTAAGTTTACGTGTCCAAATTTCTCGAGAAATTTGGACACGTAAACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002526.2-1745s21c1
Sequence:CCGGCCCATTGATGAACGCAACAATCTCGAGATTGTTGCGTTCATCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002526.2-896s21c1
Sequence:CCGGGCACTGGGAAATCATGAATTTCTCGAGAAATTCATGATTTCCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-2476s21c1
Sequence:CCGGATTAACATAGGGCCCTATAAGCTCGAGCTTATAGGGCCCTATGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-1989s21c1
Sequence:CCGGAGTGTCGAGTGCCCAGTTATGCTCGAGCATAACTGGGCACTCGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-1644s21c1
Sequence:CCGGTGATTTGTGATGCAATGATTACTCGAGTAATCATTGCATCACAAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-1419s21c1
Sequence:CCGGGCTATCTGAAGATCGAGTTTGCTCGAGCAAACTCGATCTTCAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-1238s1c1
Sequence:CCGGCCCATTGATGAACGCAACAATCTCGAGATTGTTGCGTTCATCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-1493s1c1
Sequence:CCGGCCCAGTTATGACCCTCTCAAACTCGAGTTTGAGAGGGTCATAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-1095s1c1
Sequence:CCGGCCTCTCAATCATGCCGCTTTACTCGAGTAAAGCGGCATGATTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-389s1c1
Sequence:CCGGGCACTGGGAAATCATGAATTTCTCGAGAAATTCATGATTTCCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002526.1-513s1c1
Sequence:CCGGCAGGACTTTATTTGCCATATACTCGAGTATATGGCAAATAAAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002526
VALIDATED
NT5E MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase, ecto (CD73)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-2514s21c1
Sequence:CCGGTAAGTTTACGTGTCCAAATTTCTCGAGAAATTTGGACACGTAAACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002526.2-1745s21c1
Sequence:CCGGCCCATTGATGAACGCAACAATCTCGAGATTGTTGCGTTCATCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002526.2-896s21c1
Sequence:CCGGGCACTGGGAAATCATGAATTTCTCGAGAAATTCATGATTTCCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-2476s21c1
Sequence:CCGGATTAACATAGGGCCCTATAAGCTCGAGCTTATAGGGCCCTATGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-1989s21c1
Sequence:CCGGAGTGTCGAGTGCCCAGTTATGCTCGAGCATAACTGGGCACTCGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-1644s21c1
Sequence:CCGGTGATTTGTGATGCAATGATTACTCGAGTAATCATTGCATCACAAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_002526.2-1419s21c1
Sequence:CCGGGCTATCTGAAGATCGAGTTTGCTCGAGCAAACTCGATCTTCAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-1238s1c1
Sequence:CCGGCCCATTGATGAACGCAACAATCTCGAGATTGTTGCGTTCATCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-1493s1c1
Sequence:CCGGCCCAGTTATGACCCTCTCAAACTCGAGTTTGAGAGGGTCATAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-1095s1c1
Sequence:CCGGCCTCTCAATCATGCCGCTTTACTCGAGTAAAGCGGCATGATTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002526.1-389s1c1
Sequence:CCGGGCACTGGGAAATCATGAATTTCTCGAGAAATTCATGATTTCCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002526.1-513s1c1
Sequence:CCGGCAGGACTTTATTTGCCATATACTCGAGTATATGGCAAATAAAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011851
VALIDATED
NT5E MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase, ecto (CD73)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-1311s21c1
Sequence:CCGGCATTTGACCTCGTCCAATTAACTCGAGTTAATTGGACGAGGTCAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-1004s21c1
Sequence:CCGGGCGACCATCAAAGCAGACATTCTCGAGAATGTCTGCTTTGATGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-665s21c1
Sequence:CCGGGATAAACTAAAGACGCTAAATCTCGAGATTTAGCGTCTTTAGTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-1448s21c1
Sequence:CCGGTGGAACAGAGTGGTCCAATTACTCGAGTAATTGGACCACTCTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-2033s1c1
Sequence:CCGGGCCACATAACACATCTGGTTACTCGAGTAACCAGATGTGTTATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-1020s1c1
Sequence:CCGGGACATTAACCAATGGAGGATACTCGAGTATCCTCCATTGGTTAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-1005s1c1
Sequence:CCGGGCGACCATCAAAGCAGACATTCTCGAGAATGTCTGCTTTGATGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-1497s1c1
Sequence:CCGGCCCATCTATGAGCCTCTTGAACTCGAGTTCAAGAGGCTCATAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-843s1c1
Sequence:CCGGCCATTCATAGTCACCGCAGATCTCGAGATCTGCGGTGACTATGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011851.3-2032s21c1
Sequence:CCGGGCCACATAACACATCTGGTTACTCGAGTAACCAGATGTGTTATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011851
VALIDATED
NT5E MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase, ecto (CD73)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-1311s21c1
Sequence:CCGGCATTTGACCTCGTCCAATTAACTCGAGTTAATTGGACGAGGTCAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-1004s21c1
Sequence:CCGGGCGACCATCAAAGCAGACATTCTCGAGAATGTCTGCTTTGATGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-665s21c1
Sequence:CCGGGATAAACTAAAGACGCTAAATCTCGAGATTTAGCGTCTTTAGTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-1448s21c1
Sequence:CCGGTGGAACAGAGTGGTCCAATTACTCGAGTAATTGGACCACTCTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-2033s1c1
Sequence:CCGGGCCACATAACACATCTGGTTACTCGAGTAACCAGATGTGTTATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-1020s1c1
Sequence:CCGGGACATTAACCAATGGAGGATACTCGAGTATCCTCCATTGGTTAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-1005s1c1
Sequence:CCGGGCGACCATCAAAGCAGACATTCTCGAGAATGTCTGCTTTGATGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-1497s1c1
Sequence:CCGGCCCATCTATGAGCCTCTTGAACTCGAGTTCAAGAGGCTCATAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-843s1c1
Sequence:CCGGCCATTCATAGTCACCGCAGATCTCGAGATCTGCGGTGACTATGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011851.3-2032s21c1
Sequence:CCGGGCCACATAACACATCTGGTTACTCGAGTAACCAGATGTGTTATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011851
VALIDATED
NT5E MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase, ecto (CD73)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-1311s21c1
Sequence:CCGGCATTTGACCTCGTCCAATTAACTCGAGTTAATTGGACGAGGTCAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-1004s21c1
Sequence:CCGGGCGACCATCAAAGCAGACATTCTCGAGAATGTCTGCTTTGATGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-665s21c1
Sequence:CCGGGATAAACTAAAGACGCTAAATCTCGAGATTTAGCGTCTTTAGTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011851.3-1448s21c1
Sequence:CCGGTGGAACAGAGTGGTCCAATTACTCGAGTAATTGGACCACTCTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-2033s1c1
Sequence:CCGGGCCACATAACACATCTGGTTACTCGAGTAACCAGATGTGTTATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-1020s1c1
Sequence:CCGGGACATTAACCAATGGAGGATACTCGAGTATCCTCCATTGGTTAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-1005s1c1
Sequence:CCGGGCGACCATCAAAGCAGACATTCTCGAGAATGTCTGCTTTGATGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-1497s1c1
Sequence:CCGGCCCATCTATGAGCCTCTTGAACTCGAGTTCAAGAGGCTCATAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011851.2-843s1c1
Sequence:CCGGCCATTCATAGTCACCGCAGATCTCGAGATCTGCGGTGACTATGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011851.3-2032s21c1
Sequence:CCGGGCCACATAACACATCTGGTTACTCGAGTAACCAGATGTGTTATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)