EMAIL THIS PAGE TO A FRIEND

NTF3

neurotrophin 3

102 Gene Product Result for
Synonyms: HDNF NGF-2 NGF2 NT3
UniProtKB ID: P20783, B7Z1T5, Q6FH50
Gene ID:
Human(4908) Summary: The protein encoded by this gene is a member of the neurotrophin family, that controls survival and differentiation of mammalian neurons. This protein is closely related to both nerve growth factor and brain-derived neurotrophic factor. It may be involved in the maintenance of the adult nervous system, and may affect development of neurons in the embryo when it is expressed in human placenta. NTF3-deficient mice generated by gene targeting display severe movement defects of the limbs. The mature peptide of this protein is identical in all mammals examined including human, pig, rat and mouse. [provided by RefSeq, Jul 2008]
Mouse(18205) neurotrophin 3
Rat(81737) neurotrophin 3
Zebrafish(386825) neurotrophin 3
cow(532393) neurotrophin 3
domestic cat(493963) neurotrophin 3
dog(486731) neurotrophin 3
chicken(428099) neurotrophin 3
naked mole-rat(101696620) neurotrophin 3
sheep(101115018) neurotrophin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
MAB5260 Anti-Nerve Growth Factor Antibody, clone 27/21 This Anti-Nerve Growth Factor Antibody, clone 27/21 is validated for use in ELISA for the detection of Nerve Growth Factor. rat, human, bovine, mouse
ELISA pricing
MAB5260Z Anti-Nerve Growth Factor Antibody, clone 27/21, azide free Detect Nerve Growth Factor using this Anti-Nerve Growth Factor Antibody, clone 27/21, azide free validated for use in ELISA, NEUT. human, bovine, rat, mouse
ELISA, neutralization pricing
AB5583 Anti-Nerve Growth Factor Antibody, pro This Anti-Nerve Growth Factor Antibody, pro is validated for use in WB, IH for the detection of Nerve Growth Factor. rat
immunohistochemistry, western blot pricing
AB9040 Anti-Nerve Growth Factor Antibody, pro Anti-Nerve Growth Factor Antibody, pro is an antibody against Nerve Growth Factor for use in IP, WB, IH. human, rat, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
MAB5264 Anti-Nerve Growth Factor Receptor (p75) Antibody, clone 8211 Anti-Nerve Growth Factor Receptor (p75) Antibody, clone 8211 is an antibody against Nerve Growth Factor Receptor (p75) for use in IC, IH, IH(P) & WB. human
immunocytochemistry, immunohistochemistry, western blot pricing
MAB5592X Anti-Nerve Growth Factor Receptor Alexa Fluor488 conjugated Antibody Anti-Nerve Growth Factor Receptor Alexa Fluor488 conjugated Antibody detects level of Nerve Growth Factor Receptor & has been published & validated for use in FC & IC. human, rat, mouse
flow cytometry, immunocytochemistry pricing
AB1532SP Anti-Neurotrophin 3 Antibody This Anti-Neurotrophin 3 Antibody is validated for use in ELISA, WB, IH for the detection of Neurotrophin 3. chicken, rat, human
ELISA, immunohistochemistry, western blot pricing
AB1532P Anti-Neurotrophin 3 Antibody Detect Neurotrophin 3 using this Anti-Neurotrophin 3 Antibody validated for use in WB, IH. rat, human, chicken
immunohistochemistry, western blot pricing
SAB1100863 Anti-NTF3 (191-203) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1300906 Anti-NTF3 (C-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB1300907 Anti-NTF3 (center) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry pricing
HPA032001 Anti-NTF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1400188 Anti-NTF3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
HPA032000 Anti-NTF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
AB15564 Anti-proNT-3 Antibody Anti-proNT-3 Antibody is an antibody against proNT-3 for use in WB, IH. mouse, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002527 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102654 Rosetta Predictions human pricing
NM_002527 Rosetta Predictions human pricing
NM_031073 Rosetta Predictions rat pricing
NM_008742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323450 predicted 511
2 SASI_Hs02_00323451 predicted 587
3 SASI_Hs02_00323452 predicted 499
4 SASI_Hs02_00323453 predicted 518
5 SASI_Hs02_00323454 predicted 547
6 SASI_Hs02_00323455 predicted 486
7 SASI_Hs02_00323456 predicted 494
8 SASI_Hs02_00323457 predicted 500
9 SASI_Hs02_00323458 predicted 528
10 SASI_Hs02_00323459 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163878 predicted 340
2 SASI_Hs02_00334004 predicted 426
3 SASI_Hs02_00334005 predicted 329
4 SASI_Hs01_00163882 predicted 350
5 SASI_Hs02_00334006 predicted 380
6 SASI_Hs01_00163884 predicted 320
7 SASI_Hs02_00334007 predicted 325
8 SASI_Hs02_00334008 predicted 337
9 SASI_Hs02_00334009 predicted 359
10 SASI_Hs02_00334010 predicted 331
11 SASI_Hs01_00163876 predicted 273
12 SASI_Hs01_00163877 predicted 201
13 SASI_Hs01_00163879 predicted 222
14 SASI_Hs01_00163880 predicted 202
15 SASI_Hs01_00163881 predicted 258
16 SASI_Hs01_00163883 predicted 383
17 SASI_Hs01_00163885 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119733 predicted 579
2 SASI_Rn01_00119734 predicted 467
3 SASI_Rn01_00119735 predicted 730
4 SASI_Rn01_00119736 predicted 404
5 SASI_Rn01_00119737 predicted 833
6 SASI_Rn01_00119738 predicted 950
7 SASI_Rn01_00119739 predicted 801
8 SASI_Rn01_00119740 predicted 386
9 SASI_Rn01_00119741 predicted 872
10 SASI_Rn02_00264316 predicted 694
11 SASI_Rn01_00119732 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141210 predicted 483
2 SASI_Mm01_00141211 predicted 353
3 SASI_Mm01_00141212 predicted 279
4 SASI_Mm01_00141213 predicted 445
5 SASI_Mm01_00141214 predicted 621
6 SASI_Mm01_00141215 predicted 689
7 SASI_Mm01_00141216 predicted 697
8 SASI_Mm01_00141217 predicted 1027
9 SASI_Mm01_00141218 predicted 292
10 SASI_Mm01_00141219 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008742
NTF3 MISSION shRNA Bacterial Glycerol Stock
neurotrophin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008742.2-1112s1c1
Sequence:CCGGCCCTTACAGTATATAAGCTTTCTCGAGAAAGCTTATATACTGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-929s1c1
Sequence:CCGGGCTGGATACGAATAGACACTTCTCGAGAAGTGTCTATTCGTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-761s1c1
Sequence:CCGGGTAACTCTCCTGTGAAACAATCTCGAGATTGTTTCACAGGAGAGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-359s1c1
Sequence:CCGGCCAAACAGATGGTGGATGTTACTCGAGTAACATCCACCATCTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-559s1c1
Sequence:CCGGCCCTTATACCTAATGGAGGATCTCGAGATCCTCCATTAGGTATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008742
NTF3 MISSION shRNA shRNA Plasmid DNA
neurotrophin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008742.2-1112s1c1
Sequence:CCGGCCCTTACAGTATATAAGCTTTCTCGAGAAAGCTTATATACTGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-929s1c1
Sequence:CCGGGCTGGATACGAATAGACACTTCTCGAGAAGTGTCTATTCGTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-761s1c1
Sequence:CCGGGTAACTCTCCTGTGAAACAATCTCGAGATTGTTTCACAGGAGAGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-359s1c1
Sequence:CCGGCCAAACAGATGGTGGATGTTACTCGAGTAACATCCACCATCTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-559s1c1
Sequence:CCGGCCCTTATACCTAATGGAGGATCTCGAGATCCTCCATTAGGTATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008742
NTF3 MISSION shRNA Lentiviral Transduction Particles
neurotrophin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008742.2-1112s1c1
Sequence:CCGGCCCTTACAGTATATAAGCTTTCTCGAGAAAGCTTATATACTGTAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-929s1c1
Sequence:CCGGGCTGGATACGAATAGACACTTCTCGAGAAGTGTCTATTCGTATCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-761s1c1
Sequence:CCGGGTAACTCTCCTGTGAAACAATCTCGAGATTGTTTCACAGGAGAGTTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-359s1c1
Sequence:CCGGCCAAACAGATGGTGGATGTTACTCGAGTAACATCCACCATCTGTTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008742.2-559s1c1
Sequence:CCGGCCCTTATACCTAATGGAGGATCTCGAGATCCTCCATTAGGTATAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002527
NTF3 MISSION shRNA Bacterial Glycerol Stock
neurotrophin 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-792s1c1
Sequence:CCGGCACTGACTTCAGAGAACAATACTCGAGTATTGTTCTCTGAAGTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-664s1c1
Sequence:CCGGCTCTCCCGTCAAACAATATTTCTCGAGAAATATTGTTTGACGGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-368s1c1
Sequence:CCGGGTGATTGCAATGGACACCGAACTCGAGTTCGGTGTCCATTGCAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-164s1c1
Sequence:CCGGCAAGGTAACAACATGGATCAACTCGAGTTGATCCATGTTGTTACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-204s1c1
Sequence:CCGGCGCTCAATTCCCTCATTATTACTCGAGTAATAATGAGGGAATTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002527.4-491s21c1
Sequence:CCGGGAAACGGTACGCGGAGCATAACTCGAGTTATGCTCCGCGTACCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002527.4-568s21c1
Sequence:CCGGAGTCATCGGCCATCGACATTCCTCGAGGAATGTCGATGGCCGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002527
NTF3 MISSION shRNA shRNA Plasmid DNA
neurotrophin 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-792s1c1
Sequence:CCGGCACTGACTTCAGAGAACAATACTCGAGTATTGTTCTCTGAAGTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-664s1c1
Sequence:CCGGCTCTCCCGTCAAACAATATTTCTCGAGAAATATTGTTTGACGGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-368s1c1
Sequence:CCGGGTGATTGCAATGGACACCGAACTCGAGTTCGGTGTCCATTGCAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-164s1c1
Sequence:CCGGCAAGGTAACAACATGGATCAACTCGAGTTGATCCATGTTGTTACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-204s1c1
Sequence:CCGGCGCTCAATTCCCTCATTATTACTCGAGTAATAATGAGGGAATTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002527.4-491s21c1
Sequence:CCGGGAAACGGTACGCGGAGCATAACTCGAGTTATGCTCCGCGTACCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002527.4-568s21c1
Sequence:CCGGAGTCATCGGCCATCGACATTCCTCGAGGAATGTCGATGGCCGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002527
NTF3 MISSION shRNA Lentiviral Transduction Particles
neurotrophin 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-792s1c1
Sequence:CCGGCACTGACTTCAGAGAACAATACTCGAGTATTGTTCTCTGAAGTCAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-664s1c1
Sequence:CCGGCTCTCCCGTCAAACAATATTTCTCGAGAAATATTGTTTGACGGGAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-368s1c1
Sequence:CCGGGTGATTGCAATGGACACCGAACTCGAGTTCGGTGTCCATTGCAATCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-164s1c1
Sequence:CCGGCAAGGTAACAACATGGATCAACTCGAGTTGATCCATGTTGTTACCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002527.3-204s1c1
Sequence:CCGGCGCTCAATTCCCTCATTATTACTCGAGTAATAATGAGGGAATTGAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002527.4-491s21c1
Sequence:CCGGGAAACGGTACGCGGAGCATAACTCGAGTTATGCTCCGCGTACCGTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002527.4-568s21c1
Sequence:CCGGAGTCATCGGCCATCGACATTCCTCGAGGAATGTCGATGGCCGATGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)