EMAIL THIS PAGE TO A FRIEND

NTF4

neurotrophin 4

56 Gene Product Result for
Synonyms: GLC10 GLC1O NT-4 NT-4/5 NT-5 NT4 NT5 NTF5
UniProtKB ID: P34130, Q6FH56
Gene ID:
Human(4909) Summary: This gene is a member of a family of neurotrophic factors, neurotrophins, that control survival and differentiation of mammalian neurons. The expression of this gene is ubiquitous and less influenced by environmental signals. While knock-outs of other neurotrophins including nerve growth factor, brain-derived neurotrophic factor, and neurotrophin 3 prove lethal during early postnatal development, NTF5-deficient mice only show minor cellular deficits and develop normally to adulthood. [provided by RefSeq, Jul 2008]
Rat(25730) neurotrophin 4
sheep(101104334) neurotrophin 4
cow(506660) neurotrophin 4
domestic cat(101100428) neurotrophin 4
dog(611987) neurotrophin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006179 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111691 MISSION® esiRNA esiRNA human NTF4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006179 Rosetta Predictions human pricing
NM_013184 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090137 predicted 700
2 SASI_Hs01_00090138 predicted 556
3 SASI_Hs01_00090139 predicted 564
4 SASI_Hs01_00090140 predicted 704
5 SASI_Hs01_00090141 predicted 721
6 SASI_Hs01_00090142 predicted 453
7 SASI_Hs01_00090143 predicted 531
8 SASI_Hs01_00090144 predicted 528
9 SASI_Hs01_00090145 predicted 707
10 SASI_Hs01_00090146 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032410 predicted 1108
2 SASI_Rn01_00032411 predicted 1094
3 SASI_Rn01_00032412 predicted 514
4 SASI_Rn01_00032413 predicted 1077
5 SASI_Rn01_00032414 predicted 518
6 SASI_Rn01_00032415 predicted 1100
7 SASI_Rn01_00032416 predicted 515
8 SASI_Rn01_00032417 predicted 566
9 SASI_Rn01_00032418 predicted 1100
10 SASI_Rn01_00032419 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006179
NTF4 MISSION shRNA Bacterial Glycerol Stock
neurotrophin 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006179.4-391s21c1
Sequence:CCGGGAAACTGCACCAGCGAGTCGTCTCGAGACGACTCGCTGGTGCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006179.4-707s21c1
Sequence:CCGGGCTGGCGATGGATTCGAATTGCTCGAGCAATTCGAATCCATCGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006179.4-792s21c1
Sequence:CCGGATAACAGAGCTGGATGCTGAGCTCGAGCTCAGCATCCAGCTCTGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006179.3-850s1c1
Sequence:CCGGGTTTGGGAACTCATCAAATAACTCGAGTTATTTGATGAGTTCCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-633s1c1
Sequence:CCGGGCACTGGGTATCTGAGTGCAACTCGAGTTGCACTCAGATACCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-546s1c1
Sequence:CCGGCTTCTTTGAAACCCGCTGCAACTCGAGTTGCAGCGGGTTTCAAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-196s1c1
Sequence:CCGGAGTGTGCCAATTGAGTCCCAACTCGAGTTGGGACTCAATTGGCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-660s1c1
Sequence:CCGGGCAGTCCTATGTGCGGGCATTCTCGAGAATGCCCGCACATAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006179
NTF4 MISSION shRNA shRNA Plasmid DNA
neurotrophin 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006179.4-391s21c1
Sequence:CCGGGAAACTGCACCAGCGAGTCGTCTCGAGACGACTCGCTGGTGCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006179.4-707s21c1
Sequence:CCGGGCTGGCGATGGATTCGAATTGCTCGAGCAATTCGAATCCATCGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006179.4-792s21c1
Sequence:CCGGATAACAGAGCTGGATGCTGAGCTCGAGCTCAGCATCCAGCTCTGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006179.3-850s1c1
Sequence:CCGGGTTTGGGAACTCATCAAATAACTCGAGTTATTTGATGAGTTCCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-633s1c1
Sequence:CCGGGCACTGGGTATCTGAGTGCAACTCGAGTTGCACTCAGATACCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-546s1c1
Sequence:CCGGCTTCTTTGAAACCCGCTGCAACTCGAGTTGCAGCGGGTTTCAAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-196s1c1
Sequence:CCGGAGTGTGCCAATTGAGTCCCAACTCGAGTTGGGACTCAATTGGCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-660s1c1
Sequence:CCGGGCAGTCCTATGTGCGGGCATTCTCGAGAATGCCCGCACATAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006179
NTF4 MISSION shRNA Lentiviral Transduction Particles
neurotrophin 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006179.4-391s21c1
Sequence:CCGGGAAACTGCACCAGCGAGTCGTCTCGAGACGACTCGCTGGTGCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006179.4-707s21c1
Sequence:CCGGGCTGGCGATGGATTCGAATTGCTCGAGCAATTCGAATCCATCGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006179.4-792s21c1
Sequence:CCGGATAACAGAGCTGGATGCTGAGCTCGAGCTCAGCATCCAGCTCTGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006179.3-850s1c1
Sequence:CCGGGTTTGGGAACTCATCAAATAACTCGAGTTATTTGATGAGTTCCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-633s1c1
Sequence:CCGGGCACTGGGTATCTGAGTGCAACTCGAGTTGCACTCAGATACCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-546s1c1
Sequence:CCGGCTTCTTTGAAACCCGCTGCAACTCGAGTTGCAGCGGGTTTCAAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-196s1c1
Sequence:CCGGAGTGTGCCAATTGAGTCCCAACTCGAGTTGGGACTCAATTGGCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006179.3-660s1c1
Sequence:CCGGGCAGTCCTATGTGCGGGCATTCTCGAGAATGCCCGCACATAGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)