EMAIL THIS PAGE TO A FRIEND

NTHL1

nth endonuclease III-like 1 (E. coli)

44 Gene Product Result for
Synonyms: NTH1 OCTS3
UniProtKB ID: P78549, Q1MVR1, Q99566, Q99794, Q9BPX2
Gene ID:
Human(4913) Summary: The protein encoded by this gene is a DNA N-glycosylase of the endonuclease III family. Like a similar protein in E. coli, the encoded protein has DNA glycosylase activity on DNA substrates containing oxidized pyrimidine residues and has apurinic/apyrimidinic lyase activity. [provided by RefSeq, Oct 2008]
Mouse(18207) nth (endonuclease III)-like 1 (E.coli)
Rat(29541) nth (endonuclease III)-like 1 (E.coli)
Zebrafish(100008368) nth endonuclease III-like 1 (E. coli)
chicken(416551) nth endonuclease III-like 1 (E. coli)
domestic cat(101083230) nth endonuclease III-like 1 (E. coli)
cow(535203) nth endonuclease III-like 1 (E. coli)
dog(610981) nth endonuclease III-like 1 (E. coli)
sheep(101113646) nth endonuclease III-like 1 (E. coli)
domestic guinea pig(100732333) nth endonuclease III-like 1 (E. coli)
naked mole-rat(101717895) nth endonuclease III-like 1 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302688 ANTI-NTHL1 (CENTER R103) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002528 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154471 MISSION® esiRNA esiRNA human NTHL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002528 Rosetta Predictions human pricing
NM_001105728 Rosetta Predictions rat pricing
NM_008743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334011 predicted 424
2 SASI_Hs02_00334012 predicted 502
3 SASI_Hs01_00052530 predicted 212
4 SASI_Hs01_00052531 predicted 558
5 SASI_Hs01_00052532 predicted 202
6 SASI_Hs01_00052533 predicted 725
7 SASI_Hs01_00052534 predicted 718
8 SASI_Hs01_00052535 predicted 210
9 SASI_Hs01_00052536 predicted 767
10 SASI_Hs01_00052537 predicted 290
11 SASI_Hs01_00052528 predicted 334
12 SASI_Hs01_00052529 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211946 predicted 432
2 SASI_Rn02_00211947 predicted 198
3 SASI_Rn02_00211948 predicted 416
4 SASI_Rn02_00211949 predicted 372
5 SASI_Rn02_00211950 predicted 843
6 SASI_Rn02_00211951 predicted 530
7 SASI_Rn02_00211952 predicted 854
8 SASI_Rn02_00211953 predicted 322
9 SASI_Rn02_00211954 predicted 212
10 SASI_Rn02_00211955 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177121 predicted 290
2 SASI_Mm01_00177123 predicted 206
3 SASI_Mm01_00177124 predicted 483
4 SASI_Mm01_00177125 predicted 404
5 SASI_Mm01_00177126 predicted 481
6 SASI_Mm01_00177127 predicted 821
7 SASI_Mm01_00177128 predicted 539
8 SASI_Mm02_00314604 predicted 435
9 SASI_Mm01_00177129 predicted 391
10 SASI_Mm01_00177130 predicted 754
11 SASI_Mm01_00177122 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008743
VALIDATED
NTHL1 MISSION shRNA Bacterial Glycerol Stock
nth endonuclease III-like 1 (E. coli)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008743.1-546s1c1
Sequence:CCGGCTTCTGGAGGAACAAGGTAAACTCGAGTTTACCTTGTTCCTCCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008743.1-313s1c1
Sequence:CCGGAGAAGCAAGAAGGATGCACCTCTCGAGAGGTGCATCCTTCTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-546s21c1
Sequence:CCGGCTTCTGGAGGAACAAGGTAAACTCGAGTTTACCTTGTTCCTCCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008743.1-202s1c1
Sequence:CCGGGTGGCCTATGAAGCGGCTAATCTCGAGATTAGCCGCTTCATAGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008743.1-780s1c1
Sequence:CCGGCCCAGAAGAGACACGCAAGAACTCGAGTTCTTGCGTGTCTCTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-493s21c1
Sequence:CCGGAGCATCCTGCAGACCGATGATCTCGAGATCATCGGTCTGCAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-831s21c1
Sequence:CCGGGAGTGAGGTCAACGGACTACTCTCGAGAGTAGTCCGTTGACCTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008743.1-293s21c1
Sequence:CCGGTGGCCAACATCCGCATCATGACTCGAGTCATGATGCGGATGTTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-722s21c1
Sequence:CCGGACACACATGTGCACAGAATAGCTCGAGCTATTCTGTGCACATGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008743.1-85s1c2
Sequence:CCGGGCGACTAGGATCGCGTCGGAACTCGAGTTCCGACGCGATCCTAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008743
VALIDATED
NTHL1 MISSION shRNA shRNA Plasmid DNA
nth endonuclease III-like 1 (E. coli)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008743.1-546s1c1
Sequence:CCGGCTTCTGGAGGAACAAGGTAAACTCGAGTTTACCTTGTTCCTCCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008743.1-313s1c1
Sequence:CCGGAGAAGCAAGAAGGATGCACCTCTCGAGAGGTGCATCCTTCTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-546s21c1
Sequence:CCGGCTTCTGGAGGAACAAGGTAAACTCGAGTTTACCTTGTTCCTCCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008743.1-202s1c1
Sequence:CCGGGTGGCCTATGAAGCGGCTAATCTCGAGATTAGCCGCTTCATAGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008743.1-780s1c1
Sequence:CCGGCCCAGAAGAGACACGCAAGAACTCGAGTTCTTGCGTGTCTCTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-493s21c1
Sequence:CCGGAGCATCCTGCAGACCGATGATCTCGAGATCATCGGTCTGCAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-831s21c1
Sequence:CCGGGAGTGAGGTCAACGGACTACTCTCGAGAGTAGTCCGTTGACCTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008743.1-293s21c1
Sequence:CCGGTGGCCAACATCCGCATCATGACTCGAGTCATGATGCGGATGTTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-722s21c1
Sequence:CCGGACACACATGTGCACAGAATAGCTCGAGCTATTCTGTGCACATGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008743.1-85s1c2
Sequence:CCGGGCGACTAGGATCGCGTCGGAACTCGAGTTCCGACGCGATCCTAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008743
VALIDATED
NTHL1 MISSION shRNA Lentiviral Transduction Particles
nth endonuclease III-like 1 (E. coli)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008743.1-546s1c1
Sequence:CCGGCTTCTGGAGGAACAAGGTAAACTCGAGTTTACCTTGTTCCTCCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008743.1-313s1c1
Sequence:CCGGAGAAGCAAGAAGGATGCACCTCTCGAGAGGTGCATCCTTCTTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-546s21c1
Sequence:CCGGCTTCTGGAGGAACAAGGTAAACTCGAGTTTACCTTGTTCCTCCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008743.1-202s1c1
Sequence:CCGGGTGGCCTATGAAGCGGCTAATCTCGAGATTAGCCGCTTCATAGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008743.1-780s1c1
Sequence:CCGGCCCAGAAGAGACACGCAAGAACTCGAGTTCTTGCGTGTCTCTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-493s21c1
Sequence:CCGGAGCATCCTGCAGACCGATGATCTCGAGATCATCGGTCTGCAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-831s21c1
Sequence:CCGGGAGTGAGGTCAACGGACTACTCTCGAGAGTAGTCCGTTGACCTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008743.1-293s21c1
Sequence:CCGGTGGCCAACATCCGCATCATGACTCGAGTCATGATGCGGATGTTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008743.1-722s21c1
Sequence:CCGGACACACATGTGCACAGAATAGCTCGAGCTATTCTGTGCACATGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008743.1-85s1c2
Sequence:CCGGGCGACTAGGATCGCGTCGGAACTCGAGTTCCGACGCGATCCTAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002528
VALIDATED
NTHL1 MISSION shRNA Bacterial Glycerol Stock
nth endonuclease III-like 1 (E. coli)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002528.4-844s1c1
Sequence:CCGGGCACGAGATCAATGGACTCTTCTCGAGAAGAGTCCATTGATCTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-427s1c1
Sequence:CCGGGATGCTCTCCAGCCAAACCAACTCGAGTTGGTTTGGCTGGAGAGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-739s1c1
Sequence:CCGGGCATGTGCACAGAATCGCCAACTCGAGTTGGCGATTCTGTGCACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-568s1c1
Sequence:CCGGGAGCAAGGTGAAATACATCAACTCGAGTTGATGTATTTCACCTTGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-562s1c1
Sequence:CCGGCTGGAGGAGCAAGGTGAAATACTCGAGTATTTCACCTTGCTCCTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002528
VALIDATED
NTHL1 MISSION shRNA shRNA Plasmid DNA
nth endonuclease III-like 1 (E. coli)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002528.4-844s1c1
Sequence:CCGGGCACGAGATCAATGGACTCTTCTCGAGAAGAGTCCATTGATCTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-427s1c1
Sequence:CCGGGATGCTCTCCAGCCAAACCAACTCGAGTTGGTTTGGCTGGAGAGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-739s1c1
Sequence:CCGGGCATGTGCACAGAATCGCCAACTCGAGTTGGCGATTCTGTGCACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-568s1c1
Sequence:CCGGGAGCAAGGTGAAATACATCAACTCGAGTTGATGTATTTCACCTTGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-562s1c1
Sequence:CCGGCTGGAGGAGCAAGGTGAAATACTCGAGTATTTCACCTTGCTCCTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002528
VALIDATED
NTHL1 MISSION shRNA Lentiviral Transduction Particles
nth endonuclease III-like 1 (E. coli)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002528.4-844s1c1
Sequence:CCGGGCACGAGATCAATGGACTCTTCTCGAGAAGAGTCCATTGATCTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-427s1c1
Sequence:CCGGGATGCTCTCCAGCCAAACCAACTCGAGTTGGTTTGGCTGGAGAGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-739s1c1
Sequence:CCGGGCATGTGCACAGAATCGCCAACTCGAGTTGGCGATTCTGTGCACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-568s1c1
Sequence:CCGGGAGCAAGGTGAAATACATCAACTCGAGTTGATGTATTTCACCTTGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002528.4-562s1c1
Sequence:CCGGCTGGAGGAGCAAGGTGAAATACTCGAGTATTTCACCTTGCTCCTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)