EMAIL THIS PAGE TO A FRIEND

NTM

neurotrimin

153 Gene Product Result for
Synonyms: HNT IGLON2 NTRI
UniProtKB ID: Q9P121, A0MTT2, Q6UXJ3, Q86VJ9
Gene ID:
Human(50863) Summary: This gene encodes a member of the IgLON (LAMP, OBCAM, Ntm) family of immunoglobulin (Ig) domain-containing glycosylphosphatidylinositol (GPI)-anchored cell adhesion molecules. The encoded protein may promote neurite outgrowth and adhesion via a homophilic mechanism. This gene is closely linked to a related family member, opioid binding protein/cell adhesion molecule-like (OPCML), on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Mouse(235106) neurotrimin
Rat(50864) neurotrimin
Zebrafish(678534) neurotrimin
Horse(100064766) neurotrimin
cow(534414) neurotrimin
chicken(395450) neurotrimin
dog(489274) neurotrimin
sheep(101118143) neurotrimin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016522 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048209 Rosetta Predictions human pricing
NM_016522 Rosetta Predictions human pricing
NM_017354 Rosetta Predictions rat pricing
NM_172290 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311692 predicted 825
2 SASI_Hs02_00311693 predicted 711
3 SASI_Hs02_00311694 predicted 1072
4 SASI_Hs02_00311695 predicted 742
5 SASI_Hs02_00311696 predicted 613
6 SASI_Hs02_00311697 predicted 758
7 SASI_Hs02_00311698 predicted 764
8 SASI_Hs02_00311699 predicted 1180
9 SASI_Hs02_00311700 predicted 818
10 SASI_Hs02_00311701 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215547 predicted 1152
2 SASI_Hs01_00215549 predicted 1042
3 SASI_Hs01_00215550 predicted 1410
4 SASI_Hs01_00215551 predicted 1079
5 SASI_Hs01_00215552 predicted 941
6 SASI_Hs01_00215553 predicted 1090
7 SASI_Hs01_00215554 predicted 1092
8 SASI_Hs01_00215556 predicted 1514
9 SASI_Hs02_00349619 predicted 1155
10 SASI_Hs02_00349620 predicted 1037
11 SASI_Hs01_00215548 predicted 1162
12 SASI_Hs01_00215555 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113465 predicted 725
2 SASI_Rn01_00113466 predicted 977
3 SASI_Rn01_00113467 predicted 895
4 SASI_Rn01_00113468 predicted 1407
5 SASI_Rn01_00113469 predicted 1302
6 SASI_Rn01_00113470 predicted 702
7 SASI_Rn01_00113471 predicted 771
8 SASI_Rn01_00113472 predicted 907
9 SASI_Rn01_00113473 predicted 912
10 SASI_Rn01_00113474 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117021 predicted 855
2 SASI_Mm02_00343776 predicted 1057
3 SASI_Mm01_00117022 predicted 1307
4 SASI_Mm01_00117023 predicted 1123
5 SASI_Mm01_00117024 predicted 617
6 SASI_Mm01_00117025 predicted 1317
7 SASI_Mm01_00117026 predicted 851
8 SASI_Mm01_00117027 predicted 626
9 SASI_Mm01_00117028 predicted 1310
10 SASI_Mm01_00117029 predicted 1211
11 SASI_Mm01_00117030 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016522
NTM MISSION shRNA Bacterial Glycerol Stock
neurotrimin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016522.2-1776s21c1
Sequence:CCGCAGCAACCAATCAGATATATACCTCGAGGTATATATCTGATTGGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-1318s1c1
Sequence:CCGGCGTGAACTATCCACCATACATCTCGAGATGTATGGTGGATAGTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-955s1c1
Sequence:CCGGGTACAGCATCGAGATCCAGAACTCGAGTTCTGGATCTCGATGCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-1424s1c1
Sequence:CCGGCAGTGGTACAAGGATGACAAACTCGAGTTTGTCATCCTTGTACCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016522.2-2170s1c1
Sequence:CCGGGCGTGTGTTGTGAAACGTGAACTCGAGTTCACGTTTCACAACACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016522.2-3089s1c1
Sequence:CCGGCCACTTGCTTTAGCCCATTATCTCGAGATAATGGGCTAAAGCAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016522.2-1102s21c1
Sequence:CCGGCATTAATGAAGGGAACAATATCTCGAGATATTGTTCCCTTCATTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-1206s1c1
Sequence:CCGGGTGAAGACGAATACTTGGAAACTCGAGTTTCCAAGTATTCGTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016522
NTM MISSION shRNA shRNA Plasmid DNA
neurotrimin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016522.2-1776s21c1
Sequence:CCGCAGCAACCAATCAGATATATACCTCGAGGTATATATCTGATTGGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-1318s1c1
Sequence:CCGGCGTGAACTATCCACCATACATCTCGAGATGTATGGTGGATAGTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-955s1c1
Sequence:CCGGGTACAGCATCGAGATCCAGAACTCGAGTTCTGGATCTCGATGCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-1424s1c1
Sequence:CCGGCAGTGGTACAAGGATGACAAACTCGAGTTTGTCATCCTTGTACCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016522.2-2170s1c1
Sequence:CCGGGCGTGTGTTGTGAAACGTGAACTCGAGTTCACGTTTCACAACACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016522.2-3089s1c1
Sequence:CCGGCCACTTGCTTTAGCCCATTATCTCGAGATAATGGGCTAAAGCAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016522.2-1102s21c1
Sequence:CCGGCATTAATGAAGGGAACAATATCTCGAGATATTGTTCCCTTCATTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-1206s1c1
Sequence:CCGGGTGAAGACGAATACTTGGAAACTCGAGTTTCCAAGTATTCGTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016522
NTM MISSION shRNA Lentiviral Transduction Particles
neurotrimin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016522.2-1776s21c1
Sequence:CCGCAGCAACCAATCAGATATATACCTCGAGGTATATATCTGATTGGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-1318s1c1
Sequence:CCGGCGTGAACTATCCACCATACATCTCGAGATGTATGGTGGATAGTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-955s1c1
Sequence:CCGGGTACAGCATCGAGATCCAGAACTCGAGTTCTGGATCTCGATGCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-1424s1c1
Sequence:CCGGCAGTGGTACAAGGATGACAAACTCGAGTTTGTCATCCTTGTACCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016522.2-2170s1c1
Sequence:CCGGGCGTGTGTTGTGAAACGTGAACTCGAGTTCACGTTTCACAACACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016522.2-3089s1c1
Sequence:CCGGCCACTTGCTTTAGCCCATTATCTCGAGATAATGGGCTAAAGCAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016522.2-1102s21c1
Sequence:CCGGCATTAATGAAGGGAACAATATCTCGAGATATTGTTCCCTTCATTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016522.2-1206s1c1
Sequence:CCGGGTGAAGACGAATACTTGGAAACTCGAGTTTCCAAGTATTCGTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172290
NTM MISSION shRNA Bacterial Glycerol Stock
neurotrimin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-857s1c1
Sequence:CCGGCGTGAACTATCCACCATACATCTCGAGATGTATGGTGGATAGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-230s1c1
Sequence:CCGGCAATTCTATCTCGTGGGCAATCTCGAGATTGCCCACGAGATAGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-963s1c1
Sequence:CCGGCAATGGTTCAAGGATGACAAACTCGAGTTTGTCATCCTTGAACCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172290.2-1617s1c1
Sequence:CCGGCCCAAATTTCATCGGTCCATACTCGAGTATGGACCGATGAAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-696s1c1
Sequence:CCGGCCTACAGTAACCTGGAGACATCTCGAGATGTCTCCAGGTTACTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172290
NTM MISSION shRNA shRNA Plasmid DNA
neurotrimin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-857s1c1
Sequence:CCGGCGTGAACTATCCACCATACATCTCGAGATGTATGGTGGATAGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-230s1c1
Sequence:CCGGCAATTCTATCTCGTGGGCAATCTCGAGATTGCCCACGAGATAGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-963s1c1
Sequence:CCGGCAATGGTTCAAGGATGACAAACTCGAGTTTGTCATCCTTGAACCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172290.2-1617s1c1
Sequence:CCGGCCCAAATTTCATCGGTCCATACTCGAGTATGGACCGATGAAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-696s1c1
Sequence:CCGGCCTACAGTAACCTGGAGACATCTCGAGATGTCTCCAGGTTACTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172290
NTM MISSION shRNA Lentiviral Transduction Particles
neurotrimin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-857s1c1
Sequence:CCGGCGTGAACTATCCACCATACATCTCGAGATGTATGGTGGATAGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-230s1c1
Sequence:CCGGCAATTCTATCTCGTGGGCAATCTCGAGATTGCCCACGAGATAGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-963s1c1
Sequence:CCGGCAATGGTTCAAGGATGACAAACTCGAGTTTGTCATCCTTGAACCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172290.2-1617s1c1
Sequence:CCGGCCCAAATTTCATCGGTCCATACTCGAGTATGGACCGATGAAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172290.2-696s1c1
Sequence:CCGGCCTACAGTAACCTGGAGACATCTCGAGATGTCTCCAGGTTACTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)