EMAIL THIS PAGE TO A FRIEND

NTMT1

N-terminal Xaa-Pro-Lys N-methyltransferase 1

57 Gene Product Result for
Synonyms: AD-003 C9orf32 HOMT1A METTL11A NRMT NTM1A
UniProtKB ID: Q9BV86, A8K4J2, A8K8G7, Q5SZB9, Q9UI28
Gene ID:
Human(28989) Summary: The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200).[supplied by OMIM, Nov 2010]
Mouse(66617) N-terminal Xaa-Pro-Lys N-methyltransferase 1
Rat(362103) N-terminal Xaa-Pro-Lys N-methyltransferase 1
Zebrafish(405834) N-terminal Xaa-Pro-Lys N-methyltransferase 1
cow(617042) methyltransferase like 11A
domestic cat(101085326) N-terminal Xaa-Pro-Lys N-methyltransferase 1
sheep(101115521) N-terminal Xaa-Pro-Lys N-methyltransferase 1
domestic guinea pig(100713196) N-terminal Xaa-Pro-Lys N-methyltransferase 1
naked mole-rat(101704679) N-terminal Xaa-Pro-Lys N-methyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014064 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014064 Rosetta Predictions human pricing
NM_001025019 Rosetta Predictions rat pricing
NM_170592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167577 predicted 517
2 SASI_Hs02_00345083 predicted 703
3 SASI_Hs02_00345084 predicted 616
4 SASI_Hs02_00345085 predicted 635
5 SASI_Hs01_00167579 predicted 443
6 SASI_Hs01_00167580 predicted 296
7 SASI_Hs01_00167581 predicted 573
8 SASI_Hs01_00167582 predicted 452
9 SASI_Hs01_00167583 predicted 507
10 SASI_Hs01_00167584 predicted 396
11 SASI_Hs01_00167576 predicted 230
12 SASI_Hs01_00167578 predicted 333
13 SASI_Hs01_00167585 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099089 predicted 817
2 SASI_Rn01_00099090 predicted 288
3 SASI_Rn01_00099091 predicted 402
4 SASI_Rn01_00099092 predicted 682
5 SASI_Rn01_00099093 predicted 440
6 SASI_Rn01_00099094 predicted 814
7 SASI_Rn01_00099095 predicted 547
8 SASI_Rn01_00099096 predicted 789
9 SASI_Rn01_00099097 predicted 287
10 SASI_Rn01_00099098 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343549 predicted 266
2 SASI_Mm01_00096728 predicted 665
3 SASI_Mm02_00343550 predicted 779
4 SASI_Mm02_00343551 predicted 420
5 SASI_Mm01_00096731 predicted 527
6 SASI_Mm01_00096732 predicted 866
7 SASI_Mm02_00343552 predicted 271
8 SASI_Mm02_00343553 predicted 950
9 SASI_Mm01_00096734 predicted 334
10 SASI_Mm01_00096735 predicted 848
11 SASI_Mm01_00096729 predicted 985
12 SASI_Mm01_00096730 predicted 594
13 SASI_Mm01_00096733 predicted 432
14 SASI_Mm01_00096736 predicted 689
15 SASI_Mm01_00096737 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014064
VALIDATED
NTMT1 MISSION shRNA Bacterial Glycerol Stock
N-terminal Xaa-Pro-Lys N-methyltransferase 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-168s1c1
Sequence:CCGGCAATTCTATTCCAAGGCCAAGCTCGAGCTTGGCCTTGGAATAGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-521s1c1
Sequence:CCGGCTCTTACGACGTGATCTGGATCTCGAGATCCAGATCACGTCGTAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-518s21c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-827s21c1
Sequence:CCGGCGATGAGATCTACCATGTCTACTCGAGTAGACATGGTAGATCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-774s1c1
Sequence:CCGGGATGAGATCTACCATGTCTATCTCGAGATAGACATGGTAGATCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014064.1-476s1c1
Sequence:CCGGGAACTACTTCTGTTGTGGGCTCTCGAGAGCCCACAACAGAAGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-396s1c1
Sequence:CCGGGAGGTGGATATGGTCGACATACTCGAGTATGTCGACCATATCCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-632s1c1
Sequence:CCGGCATCAAAGACAACATGGCCCACTCGAGTGGGCCATGTTGTCTTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014064.1-617s1c1
Sequence:CCGGCAACGGCATCATCGTCATCAACTCGAGTTGATGACGATGATGCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-276s1c1
Sequence:CCGGCGGAAGTTTCTGCAGAGGTTTCTCGAGAAACCTCTGCAGAAACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-464s1c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-183s1c1
Sequence:CCGGGCCAAGACCTACTGGAAACAACTCGAGTTGTTTCCAGTAGGTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-184s1c1
Sequence:CCGGCCAAGACCTACTGGAAACAAACTCGAGTTTGTTTCCAGTAGGTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014064.1-773s1c1
Sequence:CCGGCGATGAGATCTACCATGTCTACTCGAGTAGACATGGTAGATCTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-623s1c1
Sequence:CCGGCATCATCGTCATCAAAGACAACTCGAGTTGTCTTTGATGACGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-575s21c1
Sequence:CCGGCTCTTACGACGTGATCTGGATCTCGAGATCCAGATCACGTCGTAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-240s21c1
Sequence:CCGGGCCAAGACCTACTGGAAACAACTCGAGTTGTTTCCAGTAGGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014064
VALIDATED
NTMT1 MISSION shRNA shRNA Plasmid DNA
N-terminal Xaa-Pro-Lys N-methyltransferase 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-168s1c1
Sequence:CCGGCAATTCTATTCCAAGGCCAAGCTCGAGCTTGGCCTTGGAATAGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-521s1c1
Sequence:CCGGCTCTTACGACGTGATCTGGATCTCGAGATCCAGATCACGTCGTAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-518s21c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-827s21c1
Sequence:CCGGCGATGAGATCTACCATGTCTACTCGAGTAGACATGGTAGATCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-774s1c1
Sequence:CCGGGATGAGATCTACCATGTCTATCTCGAGATAGACATGGTAGATCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014064.1-476s1c1
Sequence:CCGGGAACTACTTCTGTTGTGGGCTCTCGAGAGCCCACAACAGAAGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-396s1c1
Sequence:CCGGGAGGTGGATATGGTCGACATACTCGAGTATGTCGACCATATCCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-632s1c1
Sequence:CCGGCATCAAAGACAACATGGCCCACTCGAGTGGGCCATGTTGTCTTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014064.1-617s1c1
Sequence:CCGGCAACGGCATCATCGTCATCAACTCGAGTTGATGACGATGATGCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-276s1c1
Sequence:CCGGCGGAAGTTTCTGCAGAGGTTTCTCGAGAAACCTCTGCAGAAACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-464s1c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-183s1c1
Sequence:CCGGGCCAAGACCTACTGGAAACAACTCGAGTTGTTTCCAGTAGGTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-184s1c1
Sequence:CCGGCCAAGACCTACTGGAAACAAACTCGAGTTTGTTTCCAGTAGGTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014064.1-773s1c1
Sequence:CCGGCGATGAGATCTACCATGTCTACTCGAGTAGACATGGTAGATCTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-623s1c1
Sequence:CCGGCATCATCGTCATCAAAGACAACTCGAGTTGTCTTTGATGACGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-575s21c1
Sequence:CCGGCTCTTACGACGTGATCTGGATCTCGAGATCCAGATCACGTCGTAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-240s21c1
Sequence:CCGGGCCAAGACCTACTGGAAACAACTCGAGTTGTTTCCAGTAGGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014064
VALIDATED
NTMT1 MISSION shRNA Lentiviral Transduction Particles
N-terminal Xaa-Pro-Lys N-methyltransferase 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-168s1c1
Sequence:CCGGCAATTCTATTCCAAGGCCAAGCTCGAGCTTGGCCTTGGAATAGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-521s1c1
Sequence:CCGGCTCTTACGACGTGATCTGGATCTCGAGATCCAGATCACGTCGTAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-518s21c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-827s21c1
Sequence:CCGGCGATGAGATCTACCATGTCTACTCGAGTAGACATGGTAGATCTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-774s1c1
Sequence:CCGGGATGAGATCTACCATGTCTATCTCGAGATAGACATGGTAGATCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014064.1-476s1c1
Sequence:CCGGGAACTACTTCTGTTGTGGGCTCTCGAGAGCCCACAACAGAAGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-396s1c1
Sequence:CCGGGAGGTGGATATGGTCGACATACTCGAGTATGTCGACCATATCCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-632s1c1
Sequence:CCGGCATCAAAGACAACATGGCCCACTCGAGTGGGCCATGTTGTCTTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014064.1-617s1c1
Sequence:CCGGCAACGGCATCATCGTCATCAACTCGAGTTGATGACGATGATGCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-276s1c1
Sequence:CCGGCGGAAGTTTCTGCAGAGGTTTCTCGAGAAACCTCTGCAGAAACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-464s1c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-183s1c1
Sequence:CCGGGCCAAGACCTACTGGAAACAACTCGAGTTGTTTCCAGTAGGTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-184s1c1
Sequence:CCGGCCAAGACCTACTGGAAACAAACTCGAGTTTGTTTCCAGTAGGTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014064.1-773s1c1
Sequence:CCGGCGATGAGATCTACCATGTCTACTCGAGTAGACATGGTAGATCTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014064.1-623s1c1
Sequence:CCGGCATCATCGTCATCAAAGACAACTCGAGTTGTCTTTGATGACGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-575s21c1
Sequence:CCGGCTCTTACGACGTGATCTGGATCTCGAGATCCAGATCACGTCGTAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014064.2-240s21c1
Sequence:CCGGGCCAAGACCTACTGGAAACAACTCGAGTTGTTTCCAGTAGGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170592
VALIDATED
NTMT1 MISSION shRNA Bacterial Glycerol Stock
N-terminal Xaa-Pro-Lys N-methyltransferase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170592.1-777s1c1
Sequence:CCGGCTGCCAGATGAGATCTACCATCTCGAGATGGTAGATCTCATCTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170592.1-1011s1c1
Sequence:CCGGCCAAGGAGAAAGACTTCACTTCTCGAGAAGTGAAGTCTTTCTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170592.1-473s1c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170592.1-524s1c1
Sequence:CCGGGCCTGGCTCCTATGACGTGATCTCGAGATCACGTCATAGGAGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170592.1-285s1c1
Sequence:CCGGCGGAAGTTTCTACAGAGGTTTCTCGAGAAACCTCTGTAGAAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-274s21c1
Sequence:CCGGTCAACAGCTCCCGGAAGTTTCCTCGAGGAAACTTCCGGGAGCTGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170592.2-857s21c1
Sequence:CCGGGCCAAGAGACACACCATTGACCTCGAGGTCAATGGTGTGTCTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-524s21c1
Sequence:CCGGGCCTGGCTCCTATGACGTGATCTCGAGATCACGTCATAGGAGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-473s21c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-188s21c1
Sequence:CCGGTTCGAAGGCCAAGACCTACTGCTCGAGCAGTAGGTCTTGGCCTTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-345s21c1
Sequence:CCGGTTGGACTGTGGCGCTGGTATTCTCGAGAATACCAGCGCCACAGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170592
VALIDATED
NTMT1 MISSION shRNA shRNA Plasmid DNA
N-terminal Xaa-Pro-Lys N-methyltransferase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170592.1-777s1c1
Sequence:CCGGCTGCCAGATGAGATCTACCATCTCGAGATGGTAGATCTCATCTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170592.1-1011s1c1
Sequence:CCGGCCAAGGAGAAAGACTTCACTTCTCGAGAAGTGAAGTCTTTCTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170592.1-473s1c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170592.1-524s1c1
Sequence:CCGGGCCTGGCTCCTATGACGTGATCTCGAGATCACGTCATAGGAGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170592.1-285s1c1
Sequence:CCGGCGGAAGTTTCTACAGAGGTTTCTCGAGAAACCTCTGTAGAAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-274s21c1
Sequence:CCGGTCAACAGCTCCCGGAAGTTTCCTCGAGGAAACTTCCGGGAGCTGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170592.2-857s21c1
Sequence:CCGGGCCAAGAGACACACCATTGACCTCGAGGTCAATGGTGTGTCTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-524s21c1
Sequence:CCGGGCCTGGCTCCTATGACGTGATCTCGAGATCACGTCATAGGAGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-473s21c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-188s21c1
Sequence:CCGGTTCGAAGGCCAAGACCTACTGCTCGAGCAGTAGGTCTTGGCCTTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-345s21c1
Sequence:CCGGTTGGACTGTGGCGCTGGTATTCTCGAGAATACCAGCGCCACAGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170592
VALIDATED
NTMT1 MISSION shRNA Lentiviral Transduction Particles
N-terminal Xaa-Pro-Lys N-methyltransferase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170592.1-777s1c1
Sequence:CCGGCTGCCAGATGAGATCTACCATCTCGAGATGGTAGATCTCATCTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170592.1-1011s1c1
Sequence:CCGGCCAAGGAGAAAGACTTCACTTCTCGAGAAGTGAAGTCTTTCTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170592.1-473s1c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_170592.1-524s1c1
Sequence:CCGGGCCTGGCTCCTATGACGTGATCTCGAGATCACGTCATAGGAGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170592.1-285s1c1
Sequence:CCGGCGGAAGTTTCTACAGAGGTTTCTCGAGAAACCTCTGTAGAAACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-274s21c1
Sequence:CCGGTCAACAGCTCCCGGAAGTTTCCTCGAGGAAACTTCCGGGAGCTGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170592.2-857s21c1
Sequence:CCGGGCCAAGAGACACACCATTGACCTCGAGGTCAATGGTGTGTCTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-524s21c1
Sequence:CCGGGCCTGGCTCCTATGACGTGATCTCGAGATCACGTCATAGGAGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-473s21c1
Sequence:CCGGCAAGAGGGTGAGGAACTACTTCTCGAGAAGTAGTTCCTCACCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-188s21c1
Sequence:CCGGTTCGAAGGCCAAGACCTACTGCTCGAGCAGTAGGTCTTGGCCTTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170592.2-345s21c1
Sequence:CCGGTTGGACTGTGGCGCTGGTATTCTCGAGAATACCAGCGCCACAGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)