EMAIL THIS PAGE TO A FRIEND

NTN1

netrin 1

54 Gene Product Result for
Synonyms: NTN1L
UniProtKB ID: O95631, E9KL51
Gene ID:
Human(9423) Summary: Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
Mouse(18208) netrin 1
Rat(114523) netrin 1
chicken(396389) netrin 1
cow(522767) netrin 1
dog(489497) netrin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063601 MISSION® esiRNA esiRNA targeting mouse Ntn1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004822 Rosetta Predictions human pricing
NM_053731 Rosetta Predictions rat pricing
NM_008744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069113 predicted 1633
2 SASI_Hs01_00069114 predicted 1504
3 SASI_Hs01_00069115 predicted 508
4 SASI_Hs01_00069116 predicted 1207
5 SASI_Hs02_00338388 predicted 831
6 SASI_Hs01_00069117 predicted 1102
7 SASI_Hs01_00069118 predicted 1631
8 SASI_Hs01_00069119 predicted 710
9 SASI_Hs01_00069121 predicted 1689
10 SASI_Hs02_00338389 predicted 482
11 SASI_Hs01_00069112 predicted 1557
12 SASI_Hs01_00069120 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086395 predicted 1160
2 SASI_Rn01_00086397 predicted 433
3 SASI_Rn01_00086398 predicted 1056
4 SASI_Rn01_00086400 predicted 805
5 SASI_Rn01_00086401 predicted 1226
6 SASI_Rn02_00266502 predicted 1160
7 SASI_Rn01_00086403 predicted 368
8 SASI_Rn01_00086404 predicted 278
9 SASI_Rn02_00266503 predicted 810
10 SASI_Rn02_00266504 predicted 377
11 SASI_Rn01_00086396 predicted 1196
12 SASI_Rn01_00086399 predicted 738
13 SASI_Rn01_00086402 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083816 predicted 1872
2 SASI_Mm02_00314605 predicted 1445
3 SASI_Mm01_00083819 predicted 712
4 SASI_Mm02_00314606 predicted 2260
5 SASI_Mm01_00083823 predicted 1816
6 SASI_Mm01_00083824 predicted 1092
7 SASI_Mm02_00314607 predicted 2313
8 SASI_Mm02_00314608 predicted 1379
9 SASI_Mm02_00314609 predicted 1803
10 SASI_Mm02_00314610 predicted 2043
11 SASI_Mm01_00083815 predicted 399
12 SASI_Mm01_00083817 predicted 1397
13 SASI_Mm01_00083818 predicted 1404
14 SASI_Mm01_00083820 predicted 571
15 SASI_Mm01_00083821 predicted 462
16 SASI_Mm01_00083822 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004822
NTN1 MISSION shRNA Bacterial Glycerol Stock
netrin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004822.2-1518s21c1
Sequence:CCGGGACTGCGATTCCTACTGCAAGCTCGAGCTTGCAGTAGGAATCGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004822.2-259s21c1
Sequence:CCGGGCATCCCGGACTTTGTCAATGCTCGAGCATTGACAAAGTCCGGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-1457s1c1
Sequence:CCGGCCCTGCATAAAGATCCCTGTACTCGAGTACAGGGATCTTTATGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-424s1c1
Sequence:CCGGCGCCTTCCTCACCGACCTCAACTCGAGTTGAGGTCGGTGAGGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-1652s1c1
Sequence:CCGGGTGAACATCATCTCCGTGTATCTCGAGATACACGGAGATGATGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-589s1c1
Sequence:CCGGCATCTACAAGTCCATGGACTACTCGAGTAGTCCATGGACTTGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-1552s1c1
Sequence:CCGGGAAGCTGAAGATTAACATGAACTCGAGTTCATGTTAATCTTCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004822
NTN1 MISSION shRNA shRNA Plasmid DNA
netrin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004822.2-1518s21c1
Sequence:CCGGGACTGCGATTCCTACTGCAAGCTCGAGCTTGCAGTAGGAATCGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004822.2-259s21c1
Sequence:CCGGGCATCCCGGACTTTGTCAATGCTCGAGCATTGACAAAGTCCGGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-1457s1c1
Sequence:CCGGCCCTGCATAAAGATCCCTGTACTCGAGTACAGGGATCTTTATGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-424s1c1
Sequence:CCGGCGCCTTCCTCACCGACCTCAACTCGAGTTGAGGTCGGTGAGGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-1652s1c1
Sequence:CCGGGTGAACATCATCTCCGTGTATCTCGAGATACACGGAGATGATGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-589s1c1
Sequence:CCGGCATCTACAAGTCCATGGACTACTCGAGTAGTCCATGGACTTGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-1552s1c1
Sequence:CCGGGAAGCTGAAGATTAACATGAACTCGAGTTCATGTTAATCTTCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004822
NTN1 MISSION shRNA Lentiviral Transduction Particles
netrin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004822.2-1518s21c1
Sequence:CCGGGACTGCGATTCCTACTGCAAGCTCGAGCTTGCAGTAGGAATCGCAGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004822.2-259s21c1
Sequence:CCGGGCATCCCGGACTTTGTCAATGCTCGAGCATTGACAAAGTCCGGGATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-1457s1c1
Sequence:CCGGCCCTGCATAAAGATCCCTGTACTCGAGTACAGGGATCTTTATGCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-424s1c1
Sequence:CCGGCGCCTTCCTCACCGACCTCAACTCGAGTTGAGGTCGGTGAGGAAGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-1652s1c1
Sequence:CCGGGTGAACATCATCTCCGTGTATCTCGAGATACACGGAGATGATGTTCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-589s1c1
Sequence:CCGGCATCTACAAGTCCATGGACTACTCGAGTAGTCCATGGACTTGTAGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004822.1-1552s1c1
Sequence:CCGGGAAGCTGAAGATTAACATGAACTCGAGTTCATGTTAATCTTCAGCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008744
NTN1 MISSION shRNA Bacterial Glycerol Stock
netrin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-1403s1c1
Sequence:CCGGCGGAAGACTGTGATTCCTATTCTCGAGAATAGGAATCACAGTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-429s1c1
Sequence:CCGGGACCTATGTGAGCCTGCAATTCTCGAGAATTGCAGGCTCACATAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-324s1c1
Sequence:CCGGCGACCTCAATAACCCGCACAACTCGAGTTGTGCGGGTTATTGAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-1065s1c1
Sequence:CCGGCTATAAGCTATCAGGGCGCAACTCGAGTTGCGCCCTGATAGCTTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-1527s1c1
Sequence:CCGGGTGGAAGTTCACCGTGAACATCTCGAGATGTTCACGGTGAACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008744
NTN1 MISSION shRNA shRNA Plasmid DNA
netrin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-1403s1c1
Sequence:CCGGCGGAAGACTGTGATTCCTATTCTCGAGAATAGGAATCACAGTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-429s1c1
Sequence:CCGGGACCTATGTGAGCCTGCAATTCTCGAGAATTGCAGGCTCACATAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-324s1c1
Sequence:CCGGCGACCTCAATAACCCGCACAACTCGAGTTGTGCGGGTTATTGAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-1065s1c1
Sequence:CCGGCTATAAGCTATCAGGGCGCAACTCGAGTTGCGCCCTGATAGCTTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-1527s1c1
Sequence:CCGGGTGGAAGTTCACCGTGAACATCTCGAGATGTTCACGGTGAACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008744
NTN1 MISSION shRNA Lentiviral Transduction Particles
netrin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-1403s1c1
Sequence:CCGGCGGAAGACTGTGATTCCTATTCTCGAGAATAGGAATCACAGTCTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-429s1c1
Sequence:CCGGGACCTATGTGAGCCTGCAATTCTCGAGAATTGCAGGCTCACATAGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-324s1c1
Sequence:CCGGCGACCTCAATAACCCGCACAACTCGAGTTGTGCGGGTTATTGAGGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-1065s1c1
Sequence:CCGGCTATAAGCTATCAGGGCGCAACTCGAGTTGCGCCCTGATAGCTTATAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008744.1-1527s1c1
Sequence:CCGGGTGGAAGTTCACCGTGAACATCTCGAGATGTTCACGGTGAACTTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???