EMAIL THIS PAGE TO A FRIEND

NTN3

netrin 3

56 Gene Product Result for
Synonyms: NTN2L
UniProtKB ID: O00634
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU202591 MISSION® esiRNA esiRNA targeting mouse Ntn3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006181 Rosetta Predictions human pricing
XM_001057434 Rosetta Predictions rat pricing
XM_343867 Rosetta Predictions rat pricing
NM_010947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341048 predicted 639
2 SASI_Hs01_00203272 predicted 761
3 SASI_Hs01_00203273 predicted 864
4 SASI_Hs01_00203274 predicted 1209
5 SASI_Hs01_00203275 predicted 599
6 SASI_Hs01_00203276 predicted 995
7 SASI_Hs01_00203277 predicted 1066
8 SASI_Hs01_00203278 predicted 775
9 SASI_Hs02_00341049 predicted 1323
10 SASI_Hs01_00203271 predicted 958
11 SASI_Hs01_00203279 predicted 1301
12 SASI_Hs01_00203280 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286329 predicted 2109
2 SASI_Rn02_00286330 predicted 1898
3 SASI_Rn02_00286331 predicted 1551
4 SASI_Rn02_00286332 predicted 1561
5 SASI_Rn02_00286333 predicted 1188
6 SASI_Rn02_00286334 predicted 842
7 SASI_Rn02_00286335 predicted 1185
8 SASI_Rn02_00286336 predicted 758
9 SASI_Rn02_00286337 predicted 938
10 SASI_Rn02_00286338 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396487 predicted 797
2 SASI_Rn02_00396488 predicted 839
3 SASI_Rn02_00396489 predicted 919
4 SASI_Rn02_00396490 predicted 834
5 SASI_Rn02_00396491 predicted 765
6 SASI_Rn02_00396492 predicted 977
7 SASI_Rn02_00396493 predicted 823
8 SASI_Rn02_00396494 predicted 936
9 SASI_Rn02_00396495 predicted 812
10 SASI_Rn02_00396496 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097542 predicted 2272
2 SASI_Mm01_00097543 predicted 666
3 SASI_Mm01_00097544 predicted 1050
4 SASI_Mm01_00097545 predicted 1582
5 SASI_Mm01_00097546 predicted 1406
6 SASI_Mm01_00097547 predicted 2269
7 SASI_Mm01_00097548 predicted 1758
8 SASI_Mm01_00097549 predicted 2381
9 SASI_Mm01_00097550 predicted 2361
10 SASI_Mm01_00097551 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006181
NTN3 MISSION shRNA Bacterial Glycerol Stock
netrin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-509s1c1
Sequence:CCGGCCTCAACGTGACTCTCACGGTCTCGAGACCGTGAGAGTCACGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-1519s21c1
Sequence:CCGGAGGACTGTGACTCGCACTGCACTCGAGTGCAGTGCGAGTCACAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-1018s21c1
Sequence:CCGGTGATCTGCGACTGTCGGCATGCTCGAGCATGCCGACAGTCGCAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-1568s1c1
Sequence:CCGGCCTAAAGAAGTTCTGCAAGAACTCGAGTTCTTGCAGAACTTCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-963s1c1
Sequence:CCGGCGCTGCAAGTGCAATGGACATCTCGAGATGTCCATTGCACTTGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-859s1c1
Sequence:CCGGACGTCCGTGTAGTGCTCACAACTCGAGTTGTGAGCACTACACGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-1556s1c1
Sequence:CCGGCTACCGCATCAGCCTAAAGAACTCGAGTTCTTTAGGCTGATGCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-919s21c1
Sequence:CCGGTCGTCCCTTACTCCTACGCAGCTCGAGCTGCGTAGGAGTAAGGGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-1171s21c1
Sequence:CCGGACATGGAGCTGTACCGACTGTCTCGAGACAGTCGGTACAGCTCCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006181
NTN3 MISSION shRNA shRNA Plasmid DNA
netrin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-509s1c1
Sequence:CCGGCCTCAACGTGACTCTCACGGTCTCGAGACCGTGAGAGTCACGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-1519s21c1
Sequence:CCGGAGGACTGTGACTCGCACTGCACTCGAGTGCAGTGCGAGTCACAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-1018s21c1
Sequence:CCGGTGATCTGCGACTGTCGGCATGCTCGAGCATGCCGACAGTCGCAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-1568s1c1
Sequence:CCGGCCTAAAGAAGTTCTGCAAGAACTCGAGTTCTTGCAGAACTTCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-963s1c1
Sequence:CCGGCGCTGCAAGTGCAATGGACATCTCGAGATGTCCATTGCACTTGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-859s1c1
Sequence:CCGGACGTCCGTGTAGTGCTCACAACTCGAGTTGTGAGCACTACACGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-1556s1c1
Sequence:CCGGCTACCGCATCAGCCTAAAGAACTCGAGTTCTTTAGGCTGATGCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-919s21c1
Sequence:CCGGTCGTCCCTTACTCCTACGCAGCTCGAGCTGCGTAGGAGTAAGGGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-1171s21c1
Sequence:CCGGACATGGAGCTGTACCGACTGTCTCGAGACAGTCGGTACAGCTCCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006181
NTN3 MISSION shRNA Lentiviral Transduction Particles
netrin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-509s1c1
Sequence:CCGGCCTCAACGTGACTCTCACGGTCTCGAGACCGTGAGAGTCACGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-1519s21c1
Sequence:CCGGAGGACTGTGACTCGCACTGCACTCGAGTGCAGTGCGAGTCACAGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-1018s21c1
Sequence:CCGGTGATCTGCGACTGTCGGCATGCTCGAGCATGCCGACAGTCGCAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-1568s1c1
Sequence:CCGGCCTAAAGAAGTTCTGCAAGAACTCGAGTTCTTGCAGAACTTCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-963s1c1
Sequence:CCGGCGCTGCAAGTGCAATGGACATCTCGAGATGTCCATTGCACTTGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-859s1c1
Sequence:CCGGACGTCCGTGTAGTGCTCACAACTCGAGTTGTGAGCACTACACGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006181.1-1556s1c1
Sequence:CCGGCTACCGCATCAGCCTAAAGAACTCGAGTTCTTTAGGCTGATGCGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-919s21c1
Sequence:CCGGTCGTCCCTTACTCCTACGCAGCTCGAGCTGCGTAGGAGTAAGGGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006181.1-1171s21c1
Sequence:CCGGACATGGAGCTGTACCGACTGTCTCGAGACAGTCGGTACAGCTCCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010947
NTN3 MISSION shRNA Bacterial Glycerol Stock
netrin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-1751s1c1
Sequence:CCGGCAGTTACCGAATCAGCCTGAACTCGAGTTCAGGCTGATTCGGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010947.3-2472s1c1
Sequence:CCGGCGGGCCAATGTGATTCATCAACTCGAGTTGATGAATCACATTGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-1188s1c1
Sequence:CCGGCGGTGTCTGTTGGACACCCATCTCGAGATGGGTGTCCAACAGACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-1461s1c1
Sequence:CCGGCGGGAGGGCTTCTATCGTGATCTCGAGATCACGATAGAAGCCCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-658s1c1
Sequence:CCGGGCACTGCAAGTCCTCTCTGTTCTCGAGAACAGAGAGGACTTGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010947
NTN3 MISSION shRNA shRNA Plasmid DNA
netrin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-1751s1c1
Sequence:CCGGCAGTTACCGAATCAGCCTGAACTCGAGTTCAGGCTGATTCGGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010947.3-2472s1c1
Sequence:CCGGCGGGCCAATGTGATTCATCAACTCGAGTTGATGAATCACATTGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-1188s1c1
Sequence:CCGGCGGTGTCTGTTGGACACCCATCTCGAGATGGGTGTCCAACAGACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-1461s1c1
Sequence:CCGGCGGGAGGGCTTCTATCGTGATCTCGAGATCACGATAGAAGCCCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-658s1c1
Sequence:CCGGGCACTGCAAGTCCTCTCTGTTCTCGAGAACAGAGAGGACTTGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010947
NTN3 MISSION shRNA Lentiviral Transduction Particles
netrin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-1751s1c1
Sequence:CCGGCAGTTACCGAATCAGCCTGAACTCGAGTTCAGGCTGATTCGGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010947.3-2472s1c1
Sequence:CCGGCGGGCCAATGTGATTCATCAACTCGAGTTGATGAATCACATTGGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-1188s1c1
Sequence:CCGGCGGTGTCTGTTGGACACCCATCTCGAGATGGGTGTCCAACAGACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-1461s1c1
Sequence:CCGGCGGGAGGGCTTCTATCGTGATCTCGAGATCACGATAGAAGCCCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010947.3-658s1c1
Sequence:CCGGGCACTGCAAGTCCTCTCTGTTCTCGAGAACAGAGAGGACTTGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)