EMAIL THIS PAGE TO A FRIEND

NTN5

netrin 5

51 Gene Product Result for
UniProtKB ID: Q8WTR8, Q8N4X9, Q8WU63
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1401984 Anti-NTN5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145807 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145807 Rosetta Predictions human pricing
XM_001080773 Rosetta Predictions rat pricing
XM_218653 Rosetta Predictions rat pricing
NM_001033356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109006 predicted 754
2 SASI_Hs02_00365363 predicted 760
3 SASI_Hs01_00109007 predicted 878
4 SASI_Hs01_00109009 predicted 1092
5 SASI_Hs02_00365364 predicted 1093
6 SASI_Hs01_00109010 predicted 1061
7 SASI_Hs01_00109012 predicted 271
8 SASI_Hs02_00365365 predicted 1087
9 SASI_Hs01_00109013 predicted 1609
10 SASI_Hs01_00109014 predicted 1047
11 SASI_Hs01_00109005 predicted 452
12 SASI_Hs01_00109008 predicted 1117
13 SASI_Hs01_00109011 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369302 predicted 1093
2 SASI_Rn02_00369303 predicted 564
3 SASI_Rn02_00369304 predicted 1141
4 SASI_Rn02_00369305 predicted 1121
5 SASI_Rn02_00369306 predicted 230
6 SASI_Rn02_00369307 predicted 1104
7 SASI_Rn02_00369308 predicted 784
8 SASI_Rn02_00369309 predicted 1081
9 SASI_Rn02_00369310 predicted 1288
10 SASI_Rn02_00369311 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377943 predicted 1089
2 SASI_Rn02_00377944 predicted 563
3 SASI_Rn02_00377945 predicted 1145
4 SASI_Rn02_00377946 predicted 1115
5 SASI_Rn02_00377947 predicted 233
6 SASI_Rn02_00377948 predicted 1109
7 SASI_Rn02_00377949 predicted 793
8 SASI_Rn02_00377950 predicted 1079
9 SASI_Rn02_00377951 predicted 1280
10 SASI_Rn02_00377952 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057721 predicted 932
2 SASI_Mm01_00057722 predicted 872
3 SASI_Mm01_00057723 predicted 970
4 SASI_Mm01_00057724 predicted 993
5 SASI_Mm01_00057725 predicted 199
6 SASI_Mm01_00057726 predicted 319
7 SASI_Mm01_00057727 predicted 1265
8 SASI_Mm01_00057728 predicted 994
9 SASI_Mm01_00057729 predicted 494
10 SASI_Mm01_00057730 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033356
NTN5 MISSION shRNA Bacterial Glycerol Stock
netrin 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-95s21c1
Sequence:CCGGCTACTGTGACCACGCCCATTACTCGAGTAATGGGCGTGGTCACAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-1404s21c1
Sequence:CCGGGAACTAAAGTGAGCTACTAATCTCGAGATTAGTAGCTCACTTTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-995s21c1
Sequence:CCGGGATACTGTCAGCAGGATTATGCTCGAGCATAATCCTGCTGACAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-935s21c1
Sequence:CCGGACCCACAGTGTCAAGGCTATTCTCGAGAATAGCCTTGACACTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033356
NTN5 MISSION shRNA shRNA Plasmid DNA
netrin 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-95s21c1
Sequence:CCGGCTACTGTGACCACGCCCATTACTCGAGTAATGGGCGTGGTCACAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-1404s21c1
Sequence:CCGGGAACTAAAGTGAGCTACTAATCTCGAGATTAGTAGCTCACTTTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-995s21c1
Sequence:CCGGGATACTGTCAGCAGGATTATGCTCGAGCATAATCCTGCTGACAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-935s21c1
Sequence:CCGGACCCACAGTGTCAAGGCTATTCTCGAGAATAGCCTTGACACTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033356
NTN5 MISSION shRNA Lentiviral Transduction Particles
netrin 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-95s21c1
Sequence:CCGGCTACTGTGACCACGCCCATTACTCGAGTAATGGGCGTGGTCACAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-1404s21c1
Sequence:CCGGGAACTAAAGTGAGCTACTAATCTCGAGATTAGTAGCTCACTTTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-995s21c1
Sequence:CCGGGATACTGTCAGCAGGATTATGCTCGAGCATAATCCTGCTGACAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033356.2-935s21c1
Sequence:CCGGACCCACAGTGTCAAGGCTATTCTCGAGAATAGCCTTGACACTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145807
NTN5 MISSION shRNA Bacterial Glycerol Stock
netrin 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-878s21c1
Sequence:CCGGACCCTAGCCAGCCTATCTTCACTCGAGTGAAGATAGGCTGGCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-277s21c1
Sequence:CCGGTGCAATGGCAGCCTGACTTTGCTCGAGCAAAGTCAGGCTGCCATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-1095s21c1
Sequence:CCGGCACTACTCCTGGTGCTTATAGCTCGAGCTATAAGCACCAGGAGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145807.1-1585s21c1
Sequence:CCGGTCGAGCACCAACAAAGTAATTCTCGAGAATTACTTTGTTGGTGCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-1166s21c1
Sequence:CCGGACATGAGCCTTCGGAGGTACTCTCGAGAGTACCTCCGAAGGCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145807
NTN5 MISSION shRNA shRNA Plasmid DNA
netrin 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-878s21c1
Sequence:CCGGACCCTAGCCAGCCTATCTTCACTCGAGTGAAGATAGGCTGGCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-277s21c1
Sequence:CCGGTGCAATGGCAGCCTGACTTTGCTCGAGCAAAGTCAGGCTGCCATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-1095s21c1
Sequence:CCGGCACTACTCCTGGTGCTTATAGCTCGAGCTATAAGCACCAGGAGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145807.1-1585s21c1
Sequence:CCGGTCGAGCACCAACAAAGTAATTCTCGAGAATTACTTTGTTGGTGCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-1166s21c1
Sequence:CCGGACATGAGCCTTCGGAGGTACTCTCGAGAGTACCTCCGAAGGCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145807
NTN5 MISSION shRNA Lentiviral Transduction Particles
netrin 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-878s21c1
Sequence:CCGGACCCTAGCCAGCCTATCTTCACTCGAGTGAAGATAGGCTGGCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-277s21c1
Sequence:CCGGTGCAATGGCAGCCTGACTTTGCTCGAGCAAAGTCAGGCTGCCATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-1095s21c1
Sequence:CCGGCACTACTCCTGGTGCTTATAGCTCGAGCTATAAGCACCAGGAGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145807.1-1585s21c1
Sequence:CCGGTCGAGCACCAACAAAGTAATTCTCGAGAATTACTTTGTTGGTGCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145807.1-1166s21c1
Sequence:CCGGACATGAGCCTTCGGAGGTACTCTCGAGAGTACCTCCGAAGGCTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)