EMAIL THIS PAGE TO A FRIEND

NTNG2

netrin G2

235 Gene Product Result for
Synonyms: LHLL9381 Lmnt2 NTNG1 bA479K20.1
UniProtKB ID: Q96CW9, Q5JUJ2, Q6UXY0, Q96JH0
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032536 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098551 MISSION® esiRNA esiRNA human NTNG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032536 Rosetta Predictions human pricing
NM_001107825 Rosetta Predictions rat pricing
NM_133500 Rosetta Predictions mouse pricing
NM_133501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069834 predicted 1169
2 SASI_Hs01_00069835 predicted 923
3 SASI_Hs01_00069836 predicted 1121
4 SASI_Hs01_00069837 predicted 596
5 SASI_Hs01_00069838 predicted 865
6 SASI_Hs01_00069839 predicted 491
7 SASI_Hs01_00069840 predicted 1294
8 SASI_Hs01_00069841 predicted 570
9 SASI_Hs01_00069843 predicted 758
10 SASI_Hs02_00360046 predicted 289
11 SASI_Hs01_00069842 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232645 predicted 712
2 SASI_Rn02_00232646 predicted 857
3 SASI_Rn02_00232647 predicted 1353
4 SASI_Rn02_00232648 predicted 510
5 SASI_Rn02_00232649 predicted 1537
6 SASI_Rn02_00232650 predicted 1370
7 SASI_Rn02_00232651 predicted 367
8 SASI_Rn02_00232652 predicted 1604
9 SASI_Rn02_00232653 predicted 1468
10 SASI_Rn02_00232654 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078841 predicted 272
2 SASI_Mm01_00078842 predicted 306
3 SASI_Mm01_00078843 predicted 1337
4 SASI_Mm01_00078844 predicted 624
5 SASI_Mm01_00078845 predicted 503
6 SASI_Mm01_00078846 predicted 794
7 SASI_Mm01_00078847 predicted 431
8 SASI_Mm01_00078848 predicted 786
9 SASI_Mm01_00078849 predicted 350
10 SASI_Mm01_00078850 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031043 predicted 277
2 SASI_Mm01_00031044 predicted 298
3 SASI_Mm01_00031045 predicted 1516
4 SASI_Mm01_00031046 predicted 622
5 SASI_Mm01_00031047 predicted 506
6 SASI_Mm01_00031048 predicted 794
7 SASI_Mm01_00031049 predicted 434
8 SASI_Mm01_00031050 predicted 783
9 SASI_Mm01_00031051 predicted 342
10 SASI_Mm01_00031052 predicted 1439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032536
NTNG2 MISSION shRNA Bacterial Glycerol Stock
netrin G2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1294s1c1
Sequence:CCGGGAACGTCTGCATTGAGTGTAACTCGAGTTACACTCAATGCAGACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1286s1c1
Sequence:CCGGGATGATGAGAACGTCTGCATTCTCGAGAATGCAGACGTTCTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1307s1c1
Sequence:CCGGGAGTGTAACTGCAACCAGATACTCGAGTATCTGGTTGCAGTTACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032536.1-1033s1c1
Sequence:CCGGCGGCAAGTGCAAGAAGAATTTCTCGAGAAATTCTTCTTGCACTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032536.1-916s1c1
Sequence:CCGGCATCTCCAACATCGAGGTCATCTCGAGATGACCTCGATGTTGGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1132s1c1
Sequence:CCGGCTTTGGCAACTGCGAATGCTACTCGAGTAGCATTCGCAGTTGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1128s1c1
Sequence:CCGGGTTCCTTTGGCAACTGCGAATCTCGAGATTCGCAGTTGCCAAAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032536.1-1884s1c1
Sequence:CCGGGCCTGCGATTTGGTTTCGTTTCTCGAGAAACGAAACCAAATCGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032536.1-301s1c1
Sequence:CCGGGAATCCCTACCTATGCAGCAACTCGAGTTGCTGCATAGGTAGGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1171s1c1
Sequence:CCGGCAGCTACATTGACTTCCTGAACTCGAGTTCAGGAAGTCAATGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1300s1c1
Sequence:CCGGCTGCATTGAGTGTAACTGCAACTCGAGTTGCAGTTACACTCAATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032536.1-2266s1c1
Sequence:CCGGGAAACTTCGTTCTGTAGAGAACTCGAGTTCTCTACAGAACGAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032536
NTNG2 MISSION shRNA shRNA Plasmid DNA
netrin G2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1294s1c1
Sequence:CCGGGAACGTCTGCATTGAGTGTAACTCGAGTTACACTCAATGCAGACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1286s1c1
Sequence:CCGGGATGATGAGAACGTCTGCATTCTCGAGAATGCAGACGTTCTCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1307s1c1
Sequence:CCGGGAGTGTAACTGCAACCAGATACTCGAGTATCTGGTTGCAGTTACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032536.1-1033s1c1
Sequence:CCGGCGGCAAGTGCAAGAAGAATTTCTCGAGAAATTCTTCTTGCACTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032536.1-916s1c1
Sequence:CCGGCATCTCCAACATCGAGGTCATCTCGAGATGACCTCGATGTTGGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1132s1c1
Sequence:CCGGCTTTGGCAACTGCGAATGCTACTCGAGTAGCATTCGCAGTTGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1128s1c1
Sequence:CCGGGTTCCTTTGGCAACTGCGAATCTCGAGATTCGCAGTTGCCAAAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032536.1-1884s1c1
Sequence:CCGGGCCTGCGATTTGGTTTCGTTTCTCGAGAAACGAAACCAAATCGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032536.1-301s1c1
Sequence:CCGGGAATCCCTACCTATGCAGCAACTCGAGTTGCTGCATAGGTAGGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1171s1c1
Sequence:CCGGCAGCTACATTGACTTCCTGAACTCGAGTTCAGGAAGTCAATGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1300s1c1
Sequence:CCGGCTGCATTGAGTGTAACTGCAACTCGAGTTGCAGTTACACTCAATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032536.1-2266s1c1
Sequence:CCGGGAAACTTCGTTCTGTAGAGAACTCGAGTTCTCTACAGAACGAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032536
NTNG2 MISSION shRNA Lentiviral Transduction Particles
netrin G2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1294s1c1
Sequence:CCGGGAACGTCTGCATTGAGTGTAACTCGAGTTACACTCAATGCAGACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1286s1c1
Sequence:CCGGGATGATGAGAACGTCTGCATTCTCGAGAATGCAGACGTTCTCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1307s1c1
Sequence:CCGGGAGTGTAACTGCAACCAGATACTCGAGTATCTGGTTGCAGTTACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032536.1-1033s1c1
Sequence:CCGGCGGCAAGTGCAAGAAGAATTTCTCGAGAAATTCTTCTTGCACTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032536.1-916s1c1
Sequence:CCGGCATCTCCAACATCGAGGTCATCTCGAGATGACCTCGATGTTGGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1132s1c1
Sequence:CCGGCTTTGGCAACTGCGAATGCTACTCGAGTAGCATTCGCAGTTGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1128s1c1
Sequence:CCGGGTTCCTTTGGCAACTGCGAATCTCGAGATTCGCAGTTGCCAAAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032536.1-1884s1c1
Sequence:CCGGGCCTGCGATTTGGTTTCGTTTCTCGAGAAACGAAACCAAATCGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032536.1-301s1c1
Sequence:CCGGGAATCCCTACCTATGCAGCAACTCGAGTTGCTGCATAGGTAGGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1171s1c1
Sequence:CCGGCAGCTACATTGACTTCCTGAACTCGAGTTCAGGAAGTCAATGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032536.1-1300s1c1
Sequence:CCGGCTGCATTGAGTGTAACTGCAACTCGAGTTGCAGTTACACTCAATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032536.1-2266s1c1
Sequence:CCGGGAAACTTCGTTCTGTAGAGAACTCGAGTTCTCTACAGAACGAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133500
NTNG2 MISSION shRNA Bacterial Glycerol Stock
netrin G2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-277s1c1
Sequence:CCGGCGGCTTATGTTTGACAGGGAACTCGAGTTCCCTGTCAAACATAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-135s1c1
Sequence:CCGGCCTGAAGGATTATGTCAAGGTCTCGAGACCTTGACATAATCCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-1083s1c1
Sequence:CCGGCCGTTGCAGCTACATTGACTTCTCGAGAAGTCAATGTAGCTGCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-132s1c1
Sequence:CCGGGCGCCTGAAGGATTATGTCAACTCGAGTTGACATAATCCTTCAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-681s1c1
Sequence:CCGGGCGTAACATGGACAACCTGTACTCGAGTACAGGTTGTCCATGTTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133500
NTNG2 MISSION shRNA shRNA Plasmid DNA
netrin G2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-277s1c1
Sequence:CCGGCGGCTTATGTTTGACAGGGAACTCGAGTTCCCTGTCAAACATAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-135s1c1
Sequence:CCGGCCTGAAGGATTATGTCAAGGTCTCGAGACCTTGACATAATCCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-1083s1c1
Sequence:CCGGCCGTTGCAGCTACATTGACTTCTCGAGAAGTCAATGTAGCTGCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-132s1c1
Sequence:CCGGGCGCCTGAAGGATTATGTCAACTCGAGTTGACATAATCCTTCAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-681s1c1
Sequence:CCGGGCGTAACATGGACAACCTGTACTCGAGTACAGGTTGTCCATGTTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133500
NTNG2 MISSION shRNA Lentiviral Transduction Particles
netrin G2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-277s1c1
Sequence:CCGGCGGCTTATGTTTGACAGGGAACTCGAGTTCCCTGTCAAACATAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-135s1c1
Sequence:CCGGCCTGAAGGATTATGTCAAGGTCTCGAGACCTTGACATAATCCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-1083s1c1
Sequence:CCGGCCGTTGCAGCTACATTGACTTCTCGAGAAGTCAATGTAGCTGCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-132s1c1
Sequence:CCGGGCGCCTGAAGGATTATGTCAACTCGAGTTGACATAATCCTTCAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133500.1-681s1c1
Sequence:CCGGGCGTAACATGGACAACCTGTACTCGAGTACAGGTTGTCCATGTTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)