EMAIL THIS PAGE TO A FRIEND

NTPCR

nucleoside-triphosphatase, cancer-related

90 Gene Product Result for
Synonyms: C1orf57 HCR-NTPase RP4-678E16.2
UniProtKB ID: Q9BSD7
Gene ID:
Mouse(66566) nucleoside-triphosphatase, cancer-related
Rat(361443) nucleoside-triphosphatase, cancer-related
Zebrafish(445069) nucleoside-triphosphatase, cancer-related
chicken(428588) nucleoside-triphosphatase, cancer-related
dog(607237) nucleoside-triphosphatase, cancer-related
cow(521103) nucleoside-triphosphatase, cancer-related
domestic cat(101088956) nucleoside-triphosphatase, cancer-related
sheep(101112698) nucleoside-triphosphatase, cancer-related
naked mole-rat(101704716) nucleoside-triphosphatase, cancer-related
domestic guinea pig(100727971) nucleoside-triphosphatase, cancer-related
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032324 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032324 Rosetta Predictions human pricing
NM_001134573 Rosetta Predictions rat pricing
NM_025636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107743 predicted 358
2 SASI_Hs01_00107744 predicted 361
3 SASI_Hs01_00107745 predicted 316
4 SASI_Hs01_00107746 predicted 494
5 SASI_Hs01_00107747 predicted 666
6 SASI_Hs01_00107748 predicted 491
7 SASI_Hs01_00107749 predicted 353
8 SASI_Hs01_00107750 predicted 214
9 SASI_Hs01_00107751 predicted 316
10 SASI_Hs01_00107752 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257219 predicted 487
2 SASI_Rn02_00257220 predicted 479
3 SASI_Rn02_00257221 predicted 743
4 SASI_Rn02_00257222 predicted 391
5 SASI_Rn02_00257223 predicted 212
6 SASI_Rn02_00257224 predicted 418
7 SASI_Rn02_00257225 predicted 551
8 SASI_Rn02_00257226 predicted 337
9 SASI_Rn02_00257227 predicted 590
10 SASI_Rn02_00257228 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120625 predicted 323
2 SASI_Mm01_00120626 predicted 352
3 SASI_Mm01_00120627 predicted 225
4 SASI_Mm01_00120628 predicted 776
5 SASI_Mm01_00120629 predicted 491
6 SASI_Mm01_00120630 predicted 712
7 SASI_Mm01_00120632 predicted 645
8 SASI_Mm01_00120633 predicted 636
9 SASI_Mm01_00120634 predicted 808
10 SASI_Mm02_00328714 predicted 478
11 SASI_Mm01_00120631 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025636
VALIDATED
NTPCR MISSION shRNA Bacterial Glycerol Stock
nucleoside-triphosphatase, cancer-related
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025636.1-135s1c1
Sequence:CCGGCAACCTTGATCCAGAAAGCCACTCGAGTGGCTTTCTGGATCAAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025636.1-825s1c1
Sequence:CCGGGCGGTTTGAGTAAATTCTAAACTCGAGTTTAGAATTTACTCAAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025636.1-402s1c1
Sequence:CCGGCCAAACACAGAGTGTGTATCACTCGAGTGATACACACTCTGTGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-611s21c1
Sequence:CCGGACAGCCTCTTGCCAGATATTGCTCGAGCAATATCTGGCAAGAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-819s21c1
Sequence:CCGGTGCATGCGGTTTGAGTAAATTCTCGAGAATTTACTCAAACCGCATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-484s21c1
Sequence:CCGGCTGTCCACACCAGGCATTATCCTCGAGGATAATGCCTGGTGTGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-361s21c1
Sequence:CCGGGCACTTCCTGTCCTAAGAAACCTCGAGGTTTCTTAGGACAGGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-572s21c1
Sequence:CCGGGTGACGTGAAGGTGTTCAATGCTCGAGCATTGAACACCTTCACGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025636
VALIDATED
NTPCR MISSION shRNA shRNA Plasmid DNA
nucleoside-triphosphatase, cancer-related
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025636.1-135s1c1
Sequence:CCGGCAACCTTGATCCAGAAAGCCACTCGAGTGGCTTTCTGGATCAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025636.1-825s1c1
Sequence:CCGGGCGGTTTGAGTAAATTCTAAACTCGAGTTTAGAATTTACTCAAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025636.1-402s1c1
Sequence:CCGGCCAAACACAGAGTGTGTATCACTCGAGTGATACACACTCTGTGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-611s21c1
Sequence:CCGGACAGCCTCTTGCCAGATATTGCTCGAGCAATATCTGGCAAGAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-819s21c1
Sequence:CCGGTGCATGCGGTTTGAGTAAATTCTCGAGAATTTACTCAAACCGCATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-484s21c1
Sequence:CCGGCTGTCCACACCAGGCATTATCCTCGAGGATAATGCCTGGTGTGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-361s21c1
Sequence:CCGGGCACTTCCTGTCCTAAGAAACCTCGAGGTTTCTTAGGACAGGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-572s21c1
Sequence:CCGGGTGACGTGAAGGTGTTCAATGCTCGAGCATTGAACACCTTCACGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025636
VALIDATED
NTPCR MISSION shRNA Lentiviral Transduction Particles
nucleoside-triphosphatase, cancer-related
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025636.1-135s1c1
Sequence:CCGGCAACCTTGATCCAGAAAGCCACTCGAGTGGCTTTCTGGATCAAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025636.1-825s1c1
Sequence:CCGGGCGGTTTGAGTAAATTCTAAACTCGAGTTTAGAATTTACTCAAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025636.1-402s1c1
Sequence:CCGGCCAAACACAGAGTGTGTATCACTCGAGTGATACACACTCTGTGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-611s21c1
Sequence:CCGGACAGCCTCTTGCCAGATATTGCTCGAGCAATATCTGGCAAGAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-819s21c1
Sequence:CCGGTGCATGCGGTTTGAGTAAATTCTCGAGAATTTACTCAAACCGCATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-484s21c1
Sequence:CCGGCTGTCCACACCAGGCATTATCCTCGAGGATAATGCCTGGTGTGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-361s21c1
Sequence:CCGGGCACTTCCTGTCCTAAGAAACCTCGAGGTTTCTTAGGACAGGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025636.4-572s21c1
Sequence:CCGGGTGACGTGAAGGTGTTCAATGCTCGAGCATTGAACACCTTCACGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032324
VALIDATED
NTPCR MISSION shRNA Bacterial Glycerol Stock
nucleoside-triphosphatase, cancer-related
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032324.1-423s1c1
Sequence:CCGGCGATGAGATTGGGAAGATGGACTCGAGTCCATCTTCCCAATCTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032324.1-561s1c1
Sequence:CCGGCAGAAACAGAAAGGATGTGAACTCGAGTTCACATCCTTTCTGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-544s1c1
Sequence:CCGGGCTCTTGTAGAAGAAATCAGACTCGAGTCTGATTTCTTCTACAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-608s1c1
Sequence:CCGGGAAACCACCTTCTGCCAGATACTCGAGTATCTGGCAGAAGGTGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-567s1c1
Sequence:CCGGCAGAAAGGATGTGAAGGTGTTCTCGAGAACACCTTCACATCCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-579s1c1
Sequence:CCGGGAAGGTGTTTAATGTCACCAACTCGAGTTGGTGACATTAAACACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032324.1-569s1c1
Sequence:CCGGGAAAGGATGTGAAGGTGTTTACTCGAGTAAACACCTTCACATCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032324.1-175s21c1
Sequence:CCGGGGTGTGCCTGTTGATGGATTTCTCGAGAAATCCATCAACAGGCACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032324.1-547s21c1
Sequence:CCGGCTTGTAGAAGAAATCAGAAACCTCGAGGTTTCTGATTTCTTCTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032324.1-499s21c1
Sequence:CCGGACTATAATCCTTGGCACAATCCTCGAGGATTGTGCCAAGGATTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032324.1-728s21c1
Sequence:CCGGTGTCGAGGCTGTATGCCTATGCTCGAGCATAGGCATACAGCCTCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032324
VALIDATED
NTPCR MISSION shRNA shRNA Plasmid DNA
nucleoside-triphosphatase, cancer-related
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032324.1-423s1c1
Sequence:CCGGCGATGAGATTGGGAAGATGGACTCGAGTCCATCTTCCCAATCTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032324.1-561s1c1
Sequence:CCGGCAGAAACAGAAAGGATGTGAACTCGAGTTCACATCCTTTCTGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-544s1c1
Sequence:CCGGGCTCTTGTAGAAGAAATCAGACTCGAGTCTGATTTCTTCTACAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-608s1c1
Sequence:CCGGGAAACCACCTTCTGCCAGATACTCGAGTATCTGGCAGAAGGTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-567s1c1
Sequence:CCGGCAGAAAGGATGTGAAGGTGTTCTCGAGAACACCTTCACATCCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-579s1c1
Sequence:CCGGGAAGGTGTTTAATGTCACCAACTCGAGTTGGTGACATTAAACACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032324.1-569s1c1
Sequence:CCGGGAAAGGATGTGAAGGTGTTTACTCGAGTAAACACCTTCACATCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032324.1-175s21c1
Sequence:CCGGGGTGTGCCTGTTGATGGATTTCTCGAGAAATCCATCAACAGGCACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032324.1-547s21c1
Sequence:CCGGCTTGTAGAAGAAATCAGAAACCTCGAGGTTTCTGATTTCTTCTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032324.1-499s21c1
Sequence:CCGGACTATAATCCTTGGCACAATCCTCGAGGATTGTGCCAAGGATTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032324.1-728s21c1
Sequence:CCGGTGTCGAGGCTGTATGCCTATGCTCGAGCATAGGCATACAGCCTCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032324
VALIDATED
NTPCR MISSION shRNA Lentiviral Transduction Particles
nucleoside-triphosphatase, cancer-related
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032324.1-423s1c1
Sequence:CCGGCGATGAGATTGGGAAGATGGACTCGAGTCCATCTTCCCAATCTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_032324.1-561s1c1
Sequence:CCGGCAGAAACAGAAAGGATGTGAACTCGAGTTCACATCCTTTCTGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-544s1c1
Sequence:CCGGGCTCTTGTAGAAGAAATCAGACTCGAGTCTGATTTCTTCTACAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-608s1c1
Sequence:CCGGGAAACCACCTTCTGCCAGATACTCGAGTATCTGGCAGAAGGTGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-567s1c1
Sequence:CCGGCAGAAAGGATGTGAAGGTGTTCTCGAGAACACCTTCACATCCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032324.1-579s1c1
Sequence:CCGGGAAGGTGTTTAATGTCACCAACTCGAGTTGGTGACATTAAACACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032324.1-569s1c1
Sequence:CCGGGAAAGGATGTGAAGGTGTTTACTCGAGTAAACACCTTCACATCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032324.1-175s21c1
Sequence:CCGGGGTGTGCCTGTTGATGGATTTCTCGAGAAATCCATCAACAGGCACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032324.1-547s21c1
Sequence:CCGGCTTGTAGAAGAAATCAGAAACCTCGAGGTTTCTGATTTCTTCTACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032324.1-499s21c1
Sequence:CCGGACTATAATCCTTGGCACAATCCTCGAGGATTGTGCCAAGGATTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032324.1-728s21c1
Sequence:CCGGTGTCGAGGCTGTATGCCTATGCTCGAGCATAGGCATACAGCCTCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)