EMAIL THIS PAGE TO A FRIEND

NTRK1

neurotrophic tyrosine kinase, receptor, type 1

164 Gene Product Result for
Synonyms: MTC TRK TRK1 TRKA Trk-A p140-TrkA
Gene ID:
Human(4914) Summary: This gene encodes a member of the neurotrophic tyrosine kinase receptor (NTKR) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. The presence of this kinase leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in this gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. Alternate transcriptional splice variants of this gene have been found, but only three have been characterized to date. [provided by RefSeq, Jul 2008]
Mouse(18211) neurotrophic tyrosine kinase, receptor, type 1
Rat(59109) neurotrophic tyrosine kinase, receptor, type 1
Zebrafish(30546) neurotrophic tyrosine kinase, receptor, type 1
cow(353111) neurotrophic tyrosine kinase, receptor, type 1
Horse(100064594) neurotrophic tyrosine kinase, receptor, type 1
domestic cat(101081603) neurotrophic tyrosine kinase, receptor, type 1
dog(490404) neurotrophic tyrosine kinase, receptor, type 1
chicken(396337) neurotrophic tyrosine kinase, receptor, type 1
domestic guinea pig(100725325) neurotrophic tyrosine kinase, receptor, type 1
naked mole-rat(101724441) neurotrophic tyrosine kinase, receptor, type 1
Domestic Rabbit(100354292) neurotrophic tyrosine kinase, receptor, type 1
sheep(101109763) neurotrophic tyrosine kinase, receptor, type 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N8413 Anti-NTRK1 (381-395) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
N8538 Anti-NTRK1 (761-775) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300566 Anti-NTRK1 (Ab-791) antibody produced in rabbit affinity isolated antibody human
immunofluorescence pricing
HPA035799 Anti-NTRK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4300254 Anti-phospho-NTRK1 (pSer791) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence pricing
SAB4504601 Anti-phospho-Trk A (pTyr680+Tyr681) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301404 Anti-phospho-Trk A (pTyr680/681) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504600 Anti-phospho-Trk A (pTyr701) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301316 Anti-phospho-Trk A (pTyr757) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry pricing
SAB4503784 Anti-phospho-Trk A (pTyr791) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4301226 Anti-phospho-Trk A (pTyr791) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
T9691 Anti-phospho-TrkA (pTyr490) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1305087 ANTI-PHOSPHO-TRKA(Y791) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB4502031 Anti-TRK A antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4502032 Anti-TRK A antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4502033 Anti-TRK A antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB1305365 ANTI-TRKA (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
flow cytometry, western blot pricing
SAB1305370 ANTI-TRKA antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry, immunofluorescence, western blot pricing
SAB1305371 ANTI-TRKA-PY791 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
SAB5300045 Monoclonal Anti-NTRK1 antibody produced in mouse clone 6B2, ascites fluid human
ELISA, immunofluorescence, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1757 Human TrkA ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_283871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007792 Rosetta Predictions human pricing
NM_001012331 Rosetta Predictions human pricing
NM_002529 Rosetta Predictions human pricing
NM_021589 Rosetta Predictions rat pricing
NM_001033124 Rosetta Predictions mouse pricing
XM_283871 Rosetta Predictions mouse pricing
XM_899794 Rosetta Predictions mouse pricing
XM_899800 Rosetta Predictions mouse pricing
XM_899803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143160 predicted 2060
2 SASI_Hs01_00143161 predicted 688
3 SASI_Hs01_00143162 predicted 767
4 SASI_Hs01_00143163 predicted 1879
5 SASI_Hs01_00143164 predicted 2181
6 SASI_Hs01_00143165 predicted 1982
7 SASI_Hs01_00143166 predicted 2220
8 SASI_Hs01_00143167 predicted 749
9 SASI_Hs01_00143168 predicted 1978
10 SASI_Hs01_00143169 predicted 1958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181261 predicted 2126
2 SASI_Hs01_00181262 predicted 752
3 SASI_Hs01_00181263 predicted 838
4 SASI_Hs01_00181264 predicted 1951
5 SASI_Hs01_00181265 predicted 2250
6 SASI_Hs01_00181266 predicted 2048
7 SASI_Hs01_00181267 predicted 2294
8 SASI_Hs01_00181268 predicted 812
9 SASI_Hs01_00181269 predicted 2041
10 SASI_Hs01_00181270 predicted 2023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069172 predicted 2137
2 SASI_Hs01_00069173 predicted 748
3 SASI_Hs01_00069174 predicted 842
4 SASI_Hs01_00069175 predicted 1969
5 SASI_Hs01_00069176 predicted 2270
6 SASI_Hs01_00069177 predicted 2070
7 SASI_Hs01_00069178 predicted 2308
8 SASI_Hs01_00069179 predicted 814
9 SASI_Hs01_00069180 predicted 2055
10 SASI_Hs01_00069181 predicted 2036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062936 predicted 1694
2 SASI_Rn01_00062938 predicted 1653
3 SASI_Rn01_00062939 predicted 1261
4 SASI_Rn01_00062940 predicted 1820
5 SASI_Rn01_00062941 predicted 1555
6 SASI_Rn01_00062942 predicted 810
7 SASI_Rn01_00062943 predicted 1711
8 SASI_Rn01_00062944 predicted 1194
9 SASI_Rn01_00062945 predicted 1070
10 SASI_Rn02_00262632 predicted 414
11 SASI_Rn01_00062937 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288185 predicted 589
2 SASI_Mm02_00288186 predicted 760
3 SASI_Mm02_00288187 predicted 1502
4 SASI_Mm02_00288188 predicted 991
5 SASI_Mm02_00288189 predicted 2045
6 SASI_Mm02_00288190 predicted 2181
7 SASI_Mm02_00288191 predicted 1677
8 SASI_Mm02_00288192 predicted 1515
9 SASI_Mm02_00288193 predicted 600
10 SASI_Mm02_00288194 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285920 predicted 596
2 SASI_Mm01_00285921 predicted 770
3 SASI_Mm01_00285922 predicted 1373
4 SASI_Mm01_00285923 predicted 1510
5 SASI_Mm01_00285924 predicted 995
6 SASI_Mm01_00285925 predicted 2054
7 SASI_Mm01_00285926 predicted 2180
8 SASI_Mm01_00285927 predicted 1657
9 SASI_Mm01_00285928 predicted 1684
10 SASI_Mm01_00285929 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241707 predicted 590
2 SASI_Mm01_00241708 predicted 2072
3 SASI_Mm01_00241709 predicted 770
4 SASI_Mm01_00241710 predicted 1375
5 SASI_Mm01_00241711 predicted 1514
6 SASI_Mm01_00241712 predicted 1002
7 SASI_Mm01_00241713 predicted 2229
8 SASI_Mm01_00241714 predicted 1659
9 SASI_Mm01_00241715 predicted 1675
10 SASI_Mm01_00241716 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237476 predicted 660
2 SASI_Mm01_00237477 predicted 681
3 SASI_Mm01_00237478 predicted 684
4 SASI_Mm01_00237479 predicted 359
5 SASI_Mm01_00237480 predicted 298
6 SASI_Mm01_00237481 predicted 719
7 SASI_Mm01_00237482 predicted 1057
8 SASI_Mm01_00237483 predicted 732
9 SASI_Mm01_00237484 predicted 866
10 SASI_Mm01_00237485 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262208 predicted 592
2 SASI_Mm01_00262209 predicted 765
3 SASI_Mm01_00262210 predicted 1361
4 SASI_Mm01_00262211 predicted 1497
5 SASI_Mm01_00262212 predicted 1002
6 SASI_Mm01_00262213 predicted 2027
7 SASI_Mm01_00262214 predicted 2162
8 SASI_Mm01_00262215 predicted 1644
9 SASI_Mm01_00262216 predicted 1667
10 SASI_Mm01_00262217 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283871
NTRK1 MISSION shRNA Bacterial Glycerol Stock
neurotrophic tyrosine kinase, receptor, type 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000023314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283871.1-1083s1c1
Sequence:CCGGGCATGTCAACAACGGGAACTACTCGAGTAGTTCCCGTTGTTGACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283871.1-1387s1c1
Sequence:CCGGGCTGTATTAGCTCCAGAGGATCTCGAGATCCTCTGGAGCTAATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283871.1-775s1c1
Sequence:CCGGCTGGTCAATGTCACCAGTGATCTCGAGATCACTGGTGACATTGACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283871
NTRK1 MISSION shRNA shRNA Plasmid DNA
neurotrophic tyrosine kinase, receptor, type 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000023314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283871.1-1083s1c1
Sequence:CCGGGCATGTCAACAACGGGAACTACTCGAGTAGTTCCCGTTGTTGACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283871.1-1387s1c1
Sequence:CCGGGCTGTATTAGCTCCAGAGGATCTCGAGATCCTCTGGAGCTAATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283871.1-775s1c1
Sequence:CCGGCTGGTCAATGTCACCAGTGATCTCGAGATCACTGGTGACATTGACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283871
NTRK1 MISSION shRNA Lentiviral Transduction Particles
neurotrophic tyrosine kinase, receptor, type 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000023314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283871.1-1083s1c1
Sequence:CCGGGCATGTCAACAACGGGAACTACTCGAGTAGTTCCCGTTGTTGACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283871.1-1387s1c1
Sequence:CCGGGCTGTATTAGCTCCAGAGGATCTCGAGATCCTCTGGAGCTAATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283871.1-775s1c1
Sequence:CCGGCTGGTCAATGTCACCAGTGATCTCGAGATCACTGGTGACATTGACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002529
NTRK1 MISSION shRNA Bacterial Glycerol Stock
neurotrophic tyrosine kinase, receptor, type 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-1470s1c1
Sequence:CCGGCATCGAGAACCCACAATACTTCTCGAGAAGTATTGTGGGTTCTCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-2022s1c1
Sequence:CCGGTATCTACAGCACCGACTATTACTCGAGTAATAGTCGGTGCTGTAGATATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-1128s1c1
Sequence:CCGGTGCCTTCATGGACAACCCTTTCTCGAGAAAGGGTTGTCCATGAAGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-214s1c1
Sequence:CCGGTACATCGAGAACCAGCAGCATCTCGAGATGCTGCTGGTTCTCGATGTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-119s1c1
Sequence:CCGGCCTGCTGGCTTGGCTGATACTCTCGAGAGTATCAGCCAAGCCAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-757s1c1
Sequence:CCGGAGTCAGCCACGGTGATGAAATCTCGAGATTTCATCACCGTGGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-1439s1c1
Sequence:CCGGGCTGGCCATGTCCCTGCATTTCTCGAGAAATGCAGGGACATGGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-1811s1c1
Sequence:CCGGGCTCATGGTCTTTGAGTATATCTCGAGATATACTCAAAGACCATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-1360s1c1
Sequence:CCGGTGCTCCTTGTGCTCAACAAATCTCGAGATTTGTTGAGCACAAGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002529
NTRK1 MISSION shRNA shRNA Plasmid DNA
neurotrophic tyrosine kinase, receptor, type 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-1470s1c1
Sequence:CCGGCATCGAGAACCCACAATACTTCTCGAGAAGTATTGTGGGTTCTCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-2022s1c1
Sequence:CCGGTATCTACAGCACCGACTATTACTCGAGTAATAGTCGGTGCTGTAGATATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-1128s1c1
Sequence:CCGGTGCCTTCATGGACAACCCTTTCTCGAGAAAGGGTTGTCCATGAAGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-214s1c1
Sequence:CCGGTACATCGAGAACCAGCAGCATCTCGAGATGCTGCTGGTTCTCGATGTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-119s1c1
Sequence:CCGGCCTGCTGGCTTGGCTGATACTCTCGAGAGTATCAGCCAAGCCAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-757s1c1
Sequence:CCGGAGTCAGCCACGGTGATGAAATCTCGAGATTTCATCACCGTGGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-1439s1c1
Sequence:CCGGGCTGGCCATGTCCCTGCATTTCTCGAGAAATGCAGGGACATGGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-1811s1c1
Sequence:CCGGGCTCATGGTCTTTGAGTATATCTCGAGATATACTCAAAGACCATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-1360s1c1
Sequence:CCGGTGCTCCTTGTGCTCAACAAATCTCGAGATTTGTTGAGCACAAGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002529
NTRK1 MISSION shRNA Lentiviral Transduction Particles
neurotrophic tyrosine kinase, receptor, type 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-1470s1c1
Sequence:CCGGCATCGAGAACCCACAATACTTCTCGAGAAGTATTGTGGGTTCTCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-2022s1c1
Sequence:CCGGTATCTACAGCACCGACTATTACTCGAGTAATAGTCGGTGCTGTAGATATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-1128s1c1
Sequence:CCGGTGCCTTCATGGACAACCCTTTCTCGAGAAAGGGTTGTCCATGAAGGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.x-214s1c1
Sequence:CCGGTACATCGAGAACCAGCAGCATCTCGAGATGCTGCTGGTTCTCGATGTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-119s1c1
Sequence:CCGGCCTGCTGGCTTGGCTGATACTCTCGAGAGTATCAGCCAAGCCAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-757s1c1
Sequence:CCGGAGTCAGCCACGGTGATGAAATCTCGAGATTTCATCACCGTGGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-1439s1c1
Sequence:CCGGGCTGGCCATGTCCCTGCATTTCTCGAGAAATGCAGGGACATGGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-1811s1c1
Sequence:CCGGGCTCATGGTCTTTGAGTATATCTCGAGATATACTCAAAGACCATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002529.3-1360s1c1
Sequence:CCGGTGCTCCTTGTGCTCAACAAATCTCGAGATTTGTTGAGCACAAGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033124
NTRK1 MISSION shRNA Bacterial Glycerol Stock
neurotrophic tyrosine kinase, receptor, type 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-1927s21c1
Sequence:CCGGGTGGCTGCTGGTATGGTATATCTCGAGATATACCATACCAGCAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-1541s21c1
Sequence:CCGGTCAAGCGCCAGGACATCATTCCTCGAGGAATGATGTCCTGGCGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-1021s21c1
Sequence:CCGGTTGGAGTCTGCGCTGACTAATCTCGAGATTAGTCAGCGCAGACTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-2050s21c1
Sequence:CCGGATCTATAGCACAGACTATTACCTCGAGGTAATAGTCTGTGCTATAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033124
NTRK1 MISSION shRNA shRNA Plasmid DNA
neurotrophic tyrosine kinase, receptor, type 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-1927s21c1
Sequence:CCGGGTGGCTGCTGGTATGGTATATCTCGAGATATACCATACCAGCAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-1541s21c1
Sequence:CCGGTCAAGCGCCAGGACATCATTCCTCGAGGAATGATGTCCTGGCGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-1021s21c1
Sequence:CCGGTTGGAGTCTGCGCTGACTAATCTCGAGATTAGTCAGCGCAGACTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-2050s21c1
Sequence:CCGGATCTATAGCACAGACTATTACCTCGAGGTAATAGTCTGTGCTATAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033124
NTRK1 MISSION shRNA Lentiviral Transduction Particles
neurotrophic tyrosine kinase, receptor, type 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-1927s21c1
Sequence:CCGGGTGGCTGCTGGTATGGTATATCTCGAGATATACCATACCAGCAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-1541s21c1
Sequence:CCGGTCAAGCGCCAGGACATCATTCCTCGAGGAATGATGTCCTGGCGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-1021s21c1
Sequence:CCGGTTGGAGTCTGCGCTGACTAATCTCGAGATTAGTCAGCGCAGACTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033124.1-2050s21c1
Sequence:CCGGATCTATAGCACAGACTATTACCTCGAGGTAATAGTCTGTGCTATAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)