EMAIL THIS PAGE TO A FRIEND

NTRK2

neurotrophic tyrosine kinase, receptor, type 2

460 Gene Product Result for
Synonyms: GP145-TrkB TRKB trk-B
Gene ID:
Human(4915) Summary: This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternate transcriptional splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18212) neurotrophic tyrosine kinase, receptor, type 2
Rat(25054) neurotrophic tyrosine kinase, receptor, type 2
sheep(101116015) neurotrophic tyrosine kinase, receptor, type 2
Domestic Rabbit(100352548) neurotrophic tyrosine kinase, receptor, type 2
naked mole-rat(101720037) neurotrophic tyrosine kinase, receptor, type 2
domestic guinea pig(100723565) neurotrophic tyrosine kinase, receptor, type 2
chicken(396157) neurotrophic tyrosine kinase, receptor, type 2
cow(505824) neurotrophic tyrosine kinase, receptor, type 2
Horse(100061700) neurotrophic tyrosine kinase, receptor, type 2
domestic cat(101101347) neurotrophic tyrosine kinase, receptor, type 2
dog(484147) neurotrophic tyrosine kinase, receptor, type 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302557 ANTI-MOUSE NTRK2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
N8663 Anti-NTRK2 (346-360) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA007637 Anti-NTRK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4300255 Anti-phospho-NTRK2 (pTyr515) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence pricing
SAB4300256 Anti-phospho-NTRK2 (pTyr705) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4503785 Anti-phospho-Trk B (pTyr515) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503786 Anti-phospho-Trk B (pTyr705) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301317 Anti-phospho-Trk B (pTyr706/Tyr707) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4502034 Anti-TRK B antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502035 Anti-TRK B antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4300702 Anti-TrkB (Ab-705) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
T1941 Anti-TrkB antibody produced in goat affinity isolated antibody, lyophilized powder human
western blot pricing
WH0004915M1 Monoclonal Anti-NTRK2 antibody produced in mouse clone 4D3-F10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404150 Monoclonal Anti-NTRK2 antibody produced in mouse clone 3D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006180 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007097 Rosetta Predictions human pricing
NM_001018064 Rosetta Predictions human pricing
NM_001018065 Rosetta Predictions human pricing
NM_001018066 Rosetta Predictions human pricing
NM_006180 Rosetta Predictions human pricing
NM_012731 Rosetta Predictions rat pricing
NM_001025074 Rosetta Predictions mouse pricing
NM_008745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064023 predicted 1336
2 SASI_Hs01_00064024 predicted 1008
3 SASI_Hs01_00064025 predicted 790
4 SASI_Hs01_00064026 predicted 859
5 SASI_Hs01_00064027 predicted 1177
6 SASI_Hs01_00064028 predicted 1504
7 SASI_Hs01_00064029 predicted 1713
8 SASI_Hs01_00064030 predicted 780
9 SASI_Hs01_00064031 predicted 1156
10 SASI_Hs02_00305217 predicted 1065
11 SASI_Hs01_00064032 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109255 predicted 1717
2 SASI_Hs01_00109256 predicted 1392
3 SASI_Hs01_00109257 predicted 1174
4 SASI_Hs01_00109258 predicted 1256
5 SASI_Hs01_00109259 predicted 1558
6 SASI_Hs01_00109260 predicted 1894
7 SASI_Hs01_00109261 predicted 2097
8 SASI_Hs01_00109262 predicted 1167
9 SASI_Hs01_00109263 predicted 1545
10 SASI_Hs02_00306953 predicted 1444
11 SASI_Hs01_00109264 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091891 predicted 1722
2 SASI_Hs01_00091892 predicted 1397
3 SASI_Hs01_00091893 predicted 1177
4 SASI_Hs01_00091894 predicted 1251
5 SASI_Hs01_00091895 predicted 1560
6 SASI_Hs01_00091896 predicted 1893
7 SASI_Hs01_00091897 predicted 2096
8 SASI_Hs01_00091898 predicted 1168
9 SASI_Hs01_00091899 predicted 1537
10 SASI_Hs02_00306954 predicted 1450
11 SASI_Hs01_00091900 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202396 predicted 1726
2 SASI_Hs01_00202397 predicted 1396
3 SASI_Hs01_00202398 predicted 1176
4 SASI_Hs01_00202399 predicted 1250
5 SASI_Hs01_00202400 predicted 1557
6 SASI_Hs01_00202401 predicted 1901
7 SASI_Hs01_00202402 predicted 2102
8 SASI_Hs01_00202403 predicted 1168
9 SASI_Hs01_00202404 predicted 1536
10 SASI_Hs02_00306955 predicted 1447
11 SASI_Hs01_00202405 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058099 predicted 1718
2 SASI_Hs01_00058100 predicted 1395
3 SASI_Hs01_00058101 predicted 1183
4 SASI_Hs01_00058102 predicted 1255
5 SASI_Hs01_00058103 predicted 1560
6 SASI_Hs01_00058104 predicted 1900
7 SASI_Hs01_00058105 predicted 2098
8 SASI_Hs01_00058106 predicted 1162
9 SASI_Hs01_00058107 predicted 1542
10 SASI_Hs02_00341047 predicted 1446
11 SASI_Hs01_00058108 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099169 predicted 1120
2 SASI_Rn01_00099170 predicted 907
3 SASI_Rn01_00099171 predicted 2930
4 SASI_Rn01_00099172 predicted 1738
5 SASI_Rn01_00099173 predicted 2171
6 SASI_Rn01_00099174 predicted 2030
7 SASI_Rn02_00260074 predicted 1060
8 SASI_Rn01_00099175 predicted 1714
9 SASI_Rn02_00260075 predicted 1403
10 SASI_Rn01_00099177 predicted 1100
11 SASI_Rn01_00099176 predicted 2885
12 SASI_Rn01_00099178 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287765 predicted 1310
2 SASI_Mm01_00177238 predicted 918
3 SASI_Mm01_00177239 predicted 1693
4 SASI_Mm01_00177240 predicted 888
5 SASI_Mm01_00177241 predicted 1577
6 SASI_Mm01_00177242 predicted 837
7 SASI_Mm01_00177243 predicted 766
8 SASI_Mm01_00177245 predicted 1636
9 SASI_Mm01_00177246 predicted 574
10 SASI_Mm01_00177247 predicted 1380
11 SASI_Mm01_00177244 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314611 predicted 1384
2 SASI_Mm01_00041726 predicted 998
3 SASI_Mm01_00041727 predicted 1765
4 SASI_Mm01_00041728 predicted 968
5 SASI_Mm01_00041729 predicted 1648
6 SASI_Mm01_00041730 predicted 919
7 SASI_Mm01_00041731 predicted 843
8 SASI_Mm01_00041733 predicted 1708
9 SASI_Mm01_00041734 predicted 644
10 SASI_Mm01_00041735 predicted 1457
11 SASI_Mm01_00041732 predicted 1116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008745
NTRK2 MISSION shRNA Bacterial Glycerol Stock
neurotrophic tyrosine kinase, receptor, type 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008745.2-794s21c1
Sequence:CCGGCCGGAGAACATCACGGAAATTCTCGAGAATTTCCGTGATGTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008745.2-943s21c1
Sequence:CCGGCAGCAACCTGCGGCACATAAACTCGAGTTTATGTGCCGCAGGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-302s1c1
Sequence:CCGGCCGGCTTAAAGTTTGTGGCTTCTCGAGAAGCCACAAACTTTAAGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-1372s1c1
Sequence:CCGGCATTCCAAGTTTGGCATGAAACTCGAGTTTCATGCCAAACTTGGAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-319s1c1
Sequence:CCGGGCTTACAAAGCGTTTCTGAAACTCGAGTTTCAGAAACGCTTTGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-746s1c1
Sequence:CCGGCCTTAAGGATAACGAACATTTCTCGAGAAATGTTCGTTATCCTTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-1253s1c1
Sequence:CCGGCCACGGATGTTGCTGACCAAACTCGAGTTTGGTCAGCAACATCCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008745.2-2500s21c1
Sequence:CCGGCTACCTACCTCTCTATCATATCTCGAGATATGATAGAGAGGTAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008745
NTRK2 MISSION shRNA shRNA Plasmid DNA
neurotrophic tyrosine kinase, receptor, type 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008745.2-794s21c1
Sequence:CCGGCCGGAGAACATCACGGAAATTCTCGAGAATTTCCGTGATGTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008745.2-943s21c1
Sequence:CCGGCAGCAACCTGCGGCACATAAACTCGAGTTTATGTGCCGCAGGTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-302s1c1
Sequence:CCGGCCGGCTTAAAGTTTGTGGCTTCTCGAGAAGCCACAAACTTTAAGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-1372s1c1
Sequence:CCGGCATTCCAAGTTTGGCATGAAACTCGAGTTTCATGCCAAACTTGGAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-319s1c1
Sequence:CCGGGCTTACAAAGCGTTTCTGAAACTCGAGTTTCAGAAACGCTTTGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-746s1c1
Sequence:CCGGCCTTAAGGATAACGAACATTTCTCGAGAAATGTTCGTTATCCTTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-1253s1c1
Sequence:CCGGCCACGGATGTTGCTGACCAAACTCGAGTTTGGTCAGCAACATCCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008745.2-2500s21c1
Sequence:CCGGCTACCTACCTCTCTATCATATCTCGAGATATGATAGAGAGGTAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008745
NTRK2 MISSION shRNA Lentiviral Transduction Particles
neurotrophic tyrosine kinase, receptor, type 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008745.2-794s21c1
Sequence:CCGGCCGGAGAACATCACGGAAATTCTCGAGAATTTCCGTGATGTTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008745.2-943s21c1
Sequence:CCGGCAGCAACCTGCGGCACATAAACTCGAGTTTATGTGCCGCAGGTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-302s1c1
Sequence:CCGGCCGGCTTAAAGTTTGTGGCTTCTCGAGAAGCCACAAACTTTAAGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-1372s1c1
Sequence:CCGGCATTCCAAGTTTGGCATGAAACTCGAGTTTCATGCCAAACTTGGAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-319s1c1
Sequence:CCGGGCTTACAAAGCGTTTCTGAAACTCGAGTTTCAGAAACGCTTTGTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-746s1c1
Sequence:CCGGCCTTAAGGATAACGAACATTTCTCGAGAAATGTTCGTTATCCTTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008745.1-1253s1c1
Sequence:CCGGCCACGGATGTTGCTGACCAAACTCGAGTTTGGTCAGCAACATCCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008745.2-2500s21c1
Sequence:CCGGCTACCTACCTCTCTATCATATCTCGAGATATGATAGAGAGGTAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006180
VALIDATED
NTRK2 MISSION shRNA Bacterial Glycerol Stock
neurotrophic tyrosine kinase, receptor, type 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006180.3-5188s21c1
Sequence:CCGGGCTATTTGAATGGTCAGATATCTCGAGATATCTGACCATTCAAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-2579s21c1
Sequence:CCGGGCACATCAAGCGACATAACATCTCGAGATGTTATGTCGCTTGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006180.3-1213s1c1
Sequence:CCGGGACTGAGAAATCTGACAATTGCTCGAGCAATTGTCAGATTTCTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.3-1614s1c1
Sequence:CCGGCCTAATATGTATTGGGATGTTCTCGAGAACATCCCAATACATATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.3-5300s1c1
Sequence:CCGGCCAGATTGAAAGGGAGTGATTCTCGAGAATCACTCCCTTTCAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006180.3-5188s1c1
Sequence:CCGGGCTATTTGAATGGTCAGATATCTCGAGATATCTGACCATTCAAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.3-1878s1c1
Sequence:CCGGGCGCTTCAGTGGTTCTATAACCTCGAGGTTATAGAACCACTGAAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-1092s21c1
Sequence:CCGGATCGTGGCATTTCCGAGATTGCTCGAGCAATCTCGGAAATGCCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-1684s21c1
Sequence:CCGGCCTTAAGGATAACTAACATTTCTCGAGAAATGTTAGTTATCCTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-1968s1c1
Sequence:CCGGCCACTCCATCACATCTCCAATCTCGAGATTGGAGATGTGATGGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-1341s1c1
Sequence:CCGGCCAACTATCACATTTCTCGAACTCGAGTTCGAGAAATGTGATAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-2123s1c1
Sequence:CCGGGCACATCAAGCGACATAACATCTCGAGATGTTATGTCGCTTGATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-2918s1c1
Sequence:CCGGGAGGAAGAACATCAAGGGCATCTCGAGATGCCCTTGATGTTCTTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-1369s21c1
Sequence:CCGGTCCTGGTGGGCAATCCATTTACTCGAGTAAATGGATTGCCCACCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006180
VALIDATED
NTRK2 MISSION shRNA shRNA Plasmid DNA
neurotrophic tyrosine kinase, receptor, type 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006180.3-5188s21c1
Sequence:CCGGGCTATTTGAATGGTCAGATATCTCGAGATATCTGACCATTCAAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-2579s21c1
Sequence:CCGGGCACATCAAGCGACATAACATCTCGAGATGTTATGTCGCTTGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006180.3-1213s1c1
Sequence:CCGGGACTGAGAAATCTGACAATTGCTCGAGCAATTGTCAGATTTCTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.3-1614s1c1
Sequence:CCGGCCTAATATGTATTGGGATGTTCTCGAGAACATCCCAATACATATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.3-5300s1c1
Sequence:CCGGCCAGATTGAAAGGGAGTGATTCTCGAGAATCACTCCCTTTCAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006180.3-5188s1c1
Sequence:CCGGGCTATTTGAATGGTCAGATATCTCGAGATATCTGACCATTCAAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.3-1878s1c1
Sequence:CCGGGCGCTTCAGTGGTTCTATAACCTCGAGGTTATAGAACCACTGAAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-1092s21c1
Sequence:CCGGATCGTGGCATTTCCGAGATTGCTCGAGCAATCTCGGAAATGCCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-1684s21c1
Sequence:CCGGCCTTAAGGATAACTAACATTTCTCGAGAAATGTTAGTTATCCTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-1968s1c1
Sequence:CCGGCCACTCCATCACATCTCCAATCTCGAGATTGGAGATGTGATGGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-1341s1c1
Sequence:CCGGCCAACTATCACATTTCTCGAACTCGAGTTCGAGAAATGTGATAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-2123s1c1
Sequence:CCGGGCACATCAAGCGACATAACATCTCGAGATGTTATGTCGCTTGATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-2918s1c1
Sequence:CCGGGAGGAAGAACATCAAGGGCATCTCGAGATGCCCTTGATGTTCTTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-1369s21c1
Sequence:CCGGTCCTGGTGGGCAATCCATTTACTCGAGTAAATGGATTGCCCACCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006180
VALIDATED
NTRK2 MISSION shRNA Lentiviral Transduction Particles
neurotrophic tyrosine kinase, receptor, type 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006180.3-5188s21c1
Sequence:CCGGGCTATTTGAATGGTCAGATATCTCGAGATATCTGACCATTCAAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-2579s21c1
Sequence:CCGGGCACATCAAGCGACATAACATCTCGAGATGTTATGTCGCTTGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006180.3-1213s1c1
Sequence:CCGGGACTGAGAAATCTGACAATTGCTCGAGCAATTGTCAGATTTCTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.3-1614s1c1
Sequence:CCGGCCTAATATGTATTGGGATGTTCTCGAGAACATCCCAATACATATTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.3-5300s1c1
Sequence:CCGGCCAGATTGAAAGGGAGTGATTCTCGAGAATCACTCCCTTTCAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006180.3-5188s1c1
Sequence:CCGGGCTATTTGAATGGTCAGATATCTCGAGATATCTGACCATTCAAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.3-1878s1c1
Sequence:CCGGGCGCTTCAGTGGTTCTATAACCTCGAGGTTATAGAACCACTGAAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-1092s21c1
Sequence:CCGGATCGTGGCATTTCCGAGATTGCTCGAGCAATCTCGGAAATGCCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-1684s21c1
Sequence:CCGGCCTTAAGGATAACTAACATTTCTCGAGAAATGTTAGTTATCCTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-1968s1c1
Sequence:CCGGCCACTCCATCACATCTCCAATCTCGAGATTGGAGATGTGATGGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-1341s1c1
Sequence:CCGGCCAACTATCACATTTCTCGAACTCGAGTTCGAGAAATGTGATAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-2123s1c1
Sequence:CCGGGCACATCAAGCGACATAACATCTCGAGATGTTATGTCGCTTGATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006180.x-2918s1c1
Sequence:CCGGGAGGAAGAACATCAAGGGCATCTCGAGATGCCCTTGATGTTCTTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006180.3-1369s21c1
Sequence:CCGGTCCTGGTGGGCAATCCATTTACTCGAGTAAATGGATTGCCCACCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)