EMAIL THIS PAGE TO A FRIEND

NTS

neurotensin

72 Gene Product Result for
Synonyms: NMN-125 NN NT NT/N NTS1
UniProtKB ID: P30990
Gene ID:
Human(4922) Summary: This gene encodes a common precursor for two peptides, neuromedin N and neurotensin. Neurotensin is a secreted tridecapeptide, which is widely distributed throughout the central nervous system, and may function as a neurotransmitter or a neuromodulator. It may be involved in dopamine-associated pathophysiological events, in the maintenance of gut structure and function, and in the regulation of fat metabolism. Tissue-specific processing may lead to the formation in some tissues of larger forms of neuromedin N and neurotensin. The large forms may represent more stable peptides that are also biologically active. [provided by RefSeq, Jul 2008]
Mouse(67405) neurotensin
Rat(299757) neurotensin
chicken(417883) neurotensin
cow(280881) neurotensin
dog(611687) neurotensin
sheep(101108471) neurotensin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006183 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036851 MISSION® esiRNA esiRNA human NTS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006183 Rosetta Predictions human pricing
NM_001102381 Rosetta Predictions rat pricing
NM_024435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106368 predicted 382
2 SASI_Hs01_00106369 predicted 602
3 SASI_Hs01_00106370 predicted 539
4 SASI_Hs01_00106371 predicted 708
5 SASI_Hs01_00106372 predicted 196
6 SASI_Hs01_00106374 predicted 649
7 SASI_Hs01_00106375 predicted 273
8 SASI_Hs01_00106376 predicted 246
9 SASI_Hs01_00106377 predicted 465
10 SASI_Hs02_00341053 predicted 261
11 SASI_Hs01_00106373 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211414 predicted 449
2 SASI_Rn02_00211415 predicted 252
3 SASI_Rn02_00211416 predicted 569
4 SASI_Rn02_00211417 predicted 220
5 SASI_Rn02_00211418 predicted 248
6 SASI_Rn02_00211419 predicted 424
7 SASI_Rn02_00211420 predicted 287
8 SASI_Rn02_00211421 predicted 215
9 SASI_Rn02_00211422 predicted 430
10 SASI_Rn02_00211423 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141344 predicted 844
2 SASI_Mm01_00141345 predicted 793
3 SASI_Mm01_00141346 predicted 264
4 SASI_Mm01_00141347 predicted 710
5 SASI_Mm01_00141348 predicted 661
6 SASI_Mm01_00141349 predicted 899
7 SASI_Mm01_00141350 predicted 229
8 SASI_Mm01_00141351 predicted 684
9 SASI_Mm01_00141352 predicted 272
10 SASI_Mm02_00327756 predicted 729
11 SASI_Mm01_00141353 predicted 872
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024435
NTS MISSION shRNA Bacterial Glycerol Stock
neurotensin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024435.2-927s21c1
Sequence:CCGGTAACCAAATGGAGCGTTATTACTCGAGTAATAACGCTCCATTTGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024435.2-185s21c1
Sequence:CCGGAGCCCTGGAGGCAGATCTATTCTCGAGAATAGATCTGCCTCCAGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024435.2-620s21c1
Sequence:CCGGACCTGTGATTGTGATTGATTACTCGAGTAATCAATCACAATCACAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-266s1c1
Sequence:CCGGGCTAAATGTTTGCAGCCTCATCTCGAGATGAGGCTGCAAACATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024435.2-1003s1c1
Sequence:CCGGGCTTCCCATAAACTGCTAGTTCTCGAGAACTAGCAGTTTATGGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-435s1c1
Sequence:CCGGGCCTTTCAACACTGGGAGATACTCGAGTATCTCCCAGTGTTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-215s1c1
Sequence:CCGGGCATACATCCAAGATCAGCAACTCGAGTTGCTGATCTTGGATGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-458s1c1
Sequence:CCGGCCAGGAAGATATCCTTGATAACTCGAGTTATCAAGGATATCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024435
NTS MISSION shRNA shRNA Plasmid DNA
neurotensin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024435.2-927s21c1
Sequence:CCGGTAACCAAATGGAGCGTTATTACTCGAGTAATAACGCTCCATTTGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024435.2-185s21c1
Sequence:CCGGAGCCCTGGAGGCAGATCTATTCTCGAGAATAGATCTGCCTCCAGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024435.2-620s21c1
Sequence:CCGGACCTGTGATTGTGATTGATTACTCGAGTAATCAATCACAATCACAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-266s1c1
Sequence:CCGGGCTAAATGTTTGCAGCCTCATCTCGAGATGAGGCTGCAAACATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024435.2-1003s1c1
Sequence:CCGGGCTTCCCATAAACTGCTAGTTCTCGAGAACTAGCAGTTTATGGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-435s1c1
Sequence:CCGGGCCTTTCAACACTGGGAGATACTCGAGTATCTCCCAGTGTTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-215s1c1
Sequence:CCGGGCATACATCCAAGATCAGCAACTCGAGTTGCTGATCTTGGATGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-458s1c1
Sequence:CCGGCCAGGAAGATATCCTTGATAACTCGAGTTATCAAGGATATCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024435
NTS MISSION shRNA Lentiviral Transduction Particles
neurotensin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024435.2-927s21c1
Sequence:CCGGTAACCAAATGGAGCGTTATTACTCGAGTAATAACGCTCCATTTGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024435.2-185s21c1
Sequence:CCGGAGCCCTGGAGGCAGATCTATTCTCGAGAATAGATCTGCCTCCAGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024435.2-620s21c1
Sequence:CCGGACCTGTGATTGTGATTGATTACTCGAGTAATCAATCACAATCACAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-266s1c1
Sequence:CCGGGCTAAATGTTTGCAGCCTCATCTCGAGATGAGGCTGCAAACATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024435.2-1003s1c1
Sequence:CCGGGCTTCCCATAAACTGCTAGTTCTCGAGAACTAGCAGTTTATGGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-435s1c1
Sequence:CCGGGCCTTTCAACACTGGGAGATACTCGAGTATCTCCCAGTGTTGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-215s1c1
Sequence:CCGGGCATACATCCAAGATCAGCAACTCGAGTTGCTGATCTTGGATGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024435.2-458s1c1
Sequence:CCGGCCAGGAAGATATCCTTGATAACTCGAGTTATCAAGGATATCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006183
VALIDATED
NTS MISSION shRNA Bacterial Glycerol Stock
neurotensin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-466s1c1
Sequence:CCGGAGTTAATCCAGGAAGATATTCCTCGAGGAATATCTTCCTGGATTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-707s1c1
Sequence:CCGGCACACTTATCTGTCTCTTCTACTCGAGTAGAAGAGACAGATAAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-413s1c1
Sequence:CCGGGACAATATACCAGCTCCACAACTCGAGTTGTGGAGCTGGTATATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-207s1c1
Sequence:CCGGGAAGCAGATTTCTTGACCAATCTCGAGATTGGTCAAGAAATCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-555s1c1
Sequence:CCGGCGGCAGCTGTATGAGAATAAACTCGAGTTTATTCTCATACAGCTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-281s1c1
Sequence:CCGGGCTAAATGTTTGCAGTCTTGTCTCGAGACAAGACTGCAAACATTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-247s1c1
Sequence:CCGGGTAAAGCACATGTTCCCTCTTCTCGAGAAGAGGGAACATGTGCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006183.3-398s1c1
Sequence:CCGGCTTGGAAGCAATGTTGACAATCTCGAGATTGTCAACATTGCTTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-508s1c1
Sequence:CCGGATGGAAAGGAAGAAGTCATAACTCGAGTTATGACTTCTTCCTTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006183.3-925s1c1
Sequence:CCGGCCAGCTTATGAGCTCAAAGTACTCGAGTACTTTGAGCTCATAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006183
VALIDATED
NTS MISSION shRNA shRNA Plasmid DNA
neurotensin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-466s1c1
Sequence:CCGGAGTTAATCCAGGAAGATATTCCTCGAGGAATATCTTCCTGGATTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-707s1c1
Sequence:CCGGCACACTTATCTGTCTCTTCTACTCGAGTAGAAGAGACAGATAAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-413s1c1
Sequence:CCGGGACAATATACCAGCTCCACAACTCGAGTTGTGGAGCTGGTATATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-207s1c1
Sequence:CCGGGAAGCAGATTTCTTGACCAATCTCGAGATTGGTCAAGAAATCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-555s1c1
Sequence:CCGGCGGCAGCTGTATGAGAATAAACTCGAGTTTATTCTCATACAGCTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-281s1c1
Sequence:CCGGGCTAAATGTTTGCAGTCTTGTCTCGAGACAAGACTGCAAACATTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-247s1c1
Sequence:CCGGGTAAAGCACATGTTCCCTCTTCTCGAGAAGAGGGAACATGTGCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006183.3-398s1c1
Sequence:CCGGCTTGGAAGCAATGTTGACAATCTCGAGATTGTCAACATTGCTTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-508s1c1
Sequence:CCGGATGGAAAGGAAGAAGTCATAACTCGAGTTATGACTTCTTCCTTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006183.3-925s1c1
Sequence:CCGGCCAGCTTATGAGCTCAAAGTACTCGAGTACTTTGAGCTCATAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006183
VALIDATED
NTS MISSION shRNA Lentiviral Transduction Particles
neurotensin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-466s1c1
Sequence:CCGGAGTTAATCCAGGAAGATATTCCTCGAGGAATATCTTCCTGGATTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-707s1c1
Sequence:CCGGCACACTTATCTGTCTCTTCTACTCGAGTAGAAGAGACAGATAAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-413s1c1
Sequence:CCGGGACAATATACCAGCTCCACAACTCGAGTTGTGGAGCTGGTATATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-207s1c1
Sequence:CCGGGAAGCAGATTTCTTGACCAATCTCGAGATTGGTCAAGAAATCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-555s1c1
Sequence:CCGGCGGCAGCTGTATGAGAATAAACTCGAGTTTATTCTCATACAGCTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-281s1c1
Sequence:CCGGGCTAAATGTTTGCAGTCTTGTCTCGAGACAAGACTGCAAACATTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-247s1c1
Sequence:CCGGGTAAAGCACATGTTCCCTCTTCTCGAGAAGAGGGAACATGTGCTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006183.3-398s1c1
Sequence:CCGGCTTGGAAGCAATGTTGACAATCTCGAGATTGTCAACATTGCTTCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006183.3-508s1c1
Sequence:CCGGATGGAAAGGAAGAAGTCATAACTCGAGTTATGACTTCTTCCTTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006183.3-925s1c1
Sequence:CCGGCCAGCTTATGAGCTCAAAGTACTCGAGTACTTTGAGCTCATAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)