EMAIL THIS PAGE TO A FRIEND

NUAK2

NUAK family, SNF1-like kinase, 2

45 Gene Product Result for
Synonyms: SNARK
UniProtKB ID: Q9H093
Gene ID:
Mouse(74137) NUAK family, SNF1-like kinase, 2
Rat(289419) NUAK family, SNF1-like kinase, 2
naked mole-rat(101709695) NUAK family, SNF1-like kinase, 2
Domestic Rabbit(100349342) NUAK family, SNF1-like kinase, 2
domestic guinea pig(100720544) NUAK family, SNF1-like kinase, 2
sheep(101114290) NUAK family, SNF1-like kinase, 2
Zebrafish(560275) NUAK family, SNF1-like kinase, 2
chicken(419828) NUAK family, SNF1-like kinase, 2
domestic cat(101084766) NUAK family, SNF1-like kinase, 2
cow(518632) NUAK family, SNF1-like kinase, 2
Horse(100054893) NUAK family, SNF1-like kinase, 2
dog(488570) NUAK family, SNF1-like kinase, 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030952 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030952 Rosetta Predictions human pricing
NM_001007617 Rosetta Predictions rat pricing
NM_028778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091747 predicted 766
2 SASI_Hs01_00091748 predicted 485
3 SASI_Hs01_00091749 predicted 614
4 SASI_Hs01_00091750 predicted 869
5 SASI_Hs01_00091751 predicted 866
6 SASI_Hs01_00091752 predicted 701
7 SASI_Hs01_00091753 predicted 685
8 SASI_Hs01_00091754 predicted 937
9 SASI_Hs01_00091755 predicted 356
10 SASI_Hs01_00091756 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065200 predicted 721
2 SASI_Rn01_00065201 predicted 540
3 SASI_Rn01_00065202 predicted 1073
4 SASI_Rn01_00065203 predicted 317
5 SASI_Rn01_00065204 predicted 1363
6 SASI_Rn01_00065205 predicted 732
7 SASI_Rn01_00065206 predicted 921
8 SASI_Rn01_00065207 predicted 828
9 SASI_Rn01_00065208 predicted 326
10 SASI_Rn01_00065209 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075241 predicted 639
2 SASI_Mm01_00075242 predicted 703
3 SASI_Mm01_00075243 predicted 843
4 SASI_Mm01_00075244 predicted 1234
5 SASI_Mm01_00075245 predicted 750
6 SASI_Mm01_00075246 predicted 1855
7 SASI_Mm01_00075247 predicted 1962
8 SASI_Mm01_00075248 predicted 465
9 SASI_Mm01_00075249 predicted 733
10 SASI_Mm01_00075250 predicted 1457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030952
VALIDATED
NUAK2 MISSION shRNA Bacterial Glycerol Stock
NUAK family, SNF1-like kinase, 2
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030952.1-2161s21c1
Sequence:GTACCGGGGATATGGGAAGTAGGCAAATCTCGAGATTTGCCTACTTCCCATATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-447s21c1
Sequence:CCGGTCAACCACCCTCACATCATTGCTCGAGCAATGATGTGAGGGTGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-1617s21c1
Sequence:CCGGATCGCAAAGGCATCCTCAAACCTCGAGGTTTGAGGATGCCTTTGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.1-2366s1c1
Sequence:CCGGGTACACATGGTGCCTTCTAAGCTCGAGCTTAGAAGGCACCATGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-613s1c1
Sequence:CCGGCGTGCACTATTGCCATCAGAACTCGAGTTCTGATGGCAATAGTGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-1616s1c1
Sequence:CCGGCATCGCAAAGGCATCCTCAAACTCGAGTTTGAGGATGCCTTTGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.1-3126s1c1
Sequence:CCGGGACTCTAGAATGTCCATATTTCTCGAGAAATATGGACATTCTAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-1234s1c1
Sequence:CCGGGCGCCAGCATTCGCTCAAGAACTCGAGTTCTTGAGCGAATGCTGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-571s21c1
Sequence:CCGGTGAGCGCGAAGCTAGGCATTTCTCGAGAAATGCCTAGCTTCGCGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-888s21c1
Sequence:CCGGACCATAAGATCCTAGTGAAACCTCGAGGTTTCACTAGGATCTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-1985s1c1
Sequence:CCGGGCACTGAGGGTCTGCTCAAAGCTCGAGCTTTGAGCAGACCCTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.1-2353s1c1
Sequence:CCGGCCATGAATACTCTGTACACATCTCGAGATGTGTACAGAGTATTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.x-967s1c1
Sequence:CCGGCCGGTGGCTGTTGATGGTGAACTCGAGTTCACCATCAACAGCCACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.x-887s1c1
Sequence:CCGGGACCATAAGATCCTAGTGAAACTCGAGTTTCACTAGGATCTTATGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030952.x-713s1c1
Sequence:CCGGCTCTCCAACCTCTACCATCAACTCGAGTTGATGGTAGAGGTTGGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030952.x-454s1c1
Sequence:CCGGCCCTCACATCATTGCCATCCACTCGAGTGGATGGCAATGATGTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.x-2219s1c1
Sequence:CCGGGCTGAACGAAGAGGATACTAACTCGAGTTAGTATCCTCTTCGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030952.1-2518s21c1
Sequence:CCGGTGGAGTAACGCTTCGTTATTTCTCGAGAAATAACGAAGCGTTACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030952
VALIDATED
NUAK2 MISSION shRNA shRNA Plasmid DNA
NUAK family, SNF1-like kinase, 2
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030952.1-2161s21c1
Sequence:GTACCGGGGATATGGGAAGTAGGCAAATCTCGAGATTTGCCTACTTCCCATATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-447s21c1
Sequence:CCGGTCAACCACCCTCACATCATTGCTCGAGCAATGATGTGAGGGTGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-1617s21c1
Sequence:CCGGATCGCAAAGGCATCCTCAAACCTCGAGGTTTGAGGATGCCTTTGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.1-2366s1c1
Sequence:CCGGGTACACATGGTGCCTTCTAAGCTCGAGCTTAGAAGGCACCATGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-613s1c1
Sequence:CCGGCGTGCACTATTGCCATCAGAACTCGAGTTCTGATGGCAATAGTGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-1616s1c1
Sequence:CCGGCATCGCAAAGGCATCCTCAAACTCGAGTTTGAGGATGCCTTTGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.1-3126s1c1
Sequence:CCGGGACTCTAGAATGTCCATATTTCTCGAGAAATATGGACATTCTAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-1234s1c1
Sequence:CCGGGCGCCAGCATTCGCTCAAGAACTCGAGTTCTTGAGCGAATGCTGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-571s21c1
Sequence:CCGGTGAGCGCGAAGCTAGGCATTTCTCGAGAAATGCCTAGCTTCGCGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-888s21c1
Sequence:CCGGACCATAAGATCCTAGTGAAACCTCGAGGTTTCACTAGGATCTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-1985s1c1
Sequence:CCGGGCACTGAGGGTCTGCTCAAAGCTCGAGCTTTGAGCAGACCCTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.1-2353s1c1
Sequence:CCGGCCATGAATACTCTGTACACATCTCGAGATGTGTACAGAGTATTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.x-967s1c1
Sequence:CCGGCCGGTGGCTGTTGATGGTGAACTCGAGTTCACCATCAACAGCCACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.x-887s1c1
Sequence:CCGGGACCATAAGATCCTAGTGAAACTCGAGTTTCACTAGGATCTTATGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030952.x-713s1c1
Sequence:CCGGCTCTCCAACCTCTACCATCAACTCGAGTTGATGGTAGAGGTTGGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030952.x-454s1c1
Sequence:CCGGCCCTCACATCATTGCCATCCACTCGAGTGGATGGCAATGATGTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.x-2219s1c1
Sequence:CCGGGCTGAACGAAGAGGATACTAACTCGAGTTAGTATCCTCTTCGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030952.1-2518s21c1
Sequence:CCGGTGGAGTAACGCTTCGTTATTTCTCGAGAAATAACGAAGCGTTACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030952
VALIDATED
NUAK2 MISSION shRNA Lentiviral Transduction Particles
NUAK family, SNF1-like kinase, 2
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030952.1-2161s21c1
Sequence:GTACCGGGGATATGGGAAGTAGGCAAATCTCGAGATTTGCCTACTTCCCATATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-447s21c1
Sequence:CCGGTCAACCACCCTCACATCATTGCTCGAGCAATGATGTGAGGGTGGTTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-1617s21c1
Sequence:CCGGATCGCAAAGGCATCCTCAAACCTCGAGGTTTGAGGATGCCTTTGCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.1-2366s1c1
Sequence:CCGGGTACACATGGTGCCTTCTAAGCTCGAGCTTAGAAGGCACCATGTGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-613s1c1
Sequence:CCGGCGTGCACTATTGCCATCAGAACTCGAGTTCTGATGGCAATAGTGCACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-1616s1c1
Sequence:CCGGCATCGCAAAGGCATCCTCAAACTCGAGTTTGAGGATGCCTTTGCGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.1-3126s1c1
Sequence:CCGGGACTCTAGAATGTCCATATTTCTCGAGAAATATGGACATTCTAGAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-1234s1c1
Sequence:CCGGGCGCCAGCATTCGCTCAAGAACTCGAGTTCTTGAGCGAATGCTGGCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-571s21c1
Sequence:CCGGTGAGCGCGAAGCTAGGCATTTCTCGAGAAATGCCTAGCTTCGCGCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030952.1-888s21c1
Sequence:CCGGACCATAAGATCCTAGTGAAACCTCGAGGTTTCACTAGGATCTTATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.1-1985s1c1
Sequence:CCGGGCACTGAGGGTCTGCTCAAAGCTCGAGCTTTGAGCAGACCCTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.1-2353s1c1
Sequence:CCGGCCATGAATACTCTGTACACATCTCGAGATGTGTACAGAGTATTCATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.x-967s1c1
Sequence:CCGGCCGGTGGCTGTTGATGGTGAACTCGAGTTCACCATCAACAGCCACCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030952.x-887s1c1
Sequence:CCGGGACCATAAGATCCTAGTGAAACTCGAGTTTCACTAGGATCTTATGGTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030952.x-713s1c1
Sequence:CCGGCTCTCCAACCTCTACCATCAACTCGAGTTGATGGTAGAGGTTGGAGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030952.x-454s1c1
Sequence:CCGGCCCTCACATCATTGCCATCCACTCGAGTGGATGGCAATGATGTGAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030952.x-2219s1c1
Sequence:CCGGGCTGAACGAAGAGGATACTAACTCGAGTTAGTATCCTCTTCGTTCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030952.1-2518s21c1
Sequence:CCGGTGGAGTAACGCTTCGTTATTTCTCGAGAAATAACGAAGCGTTACTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028778
NUAK2 MISSION shRNA Bacterial Glycerol Stock
NUAK family, SNF1-like kinase, 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028778.3-180s21c1
Sequence:CCGGGGGCTCATCAAGTCGCCTAAACTCGAGTTTAGGCGACTTGATGAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028778.3-852s21c1
Sequence:CCGGTTTGACGGGCAGGATCATAAACTCGAGTTTATGATCCTGCCCGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028778.3-1463s21c1
Sequence:CCGGGAAGTCTCGACAGCGTGAATCCTCGAGGATTCACGCTGTCGAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-191s1c1
Sequence:CCGGGTCGCCTAAACCTCTGATGAACTCGAGTTCATCAGAGGTTTAGGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-657s1c1
Sequence:CCGGGCCAATGGAAACATCAAGATTCTCGAGAATCTTGATGTTTCCATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028778.3-2321s21c1
Sequence:CCGGGTGTAGTGACTGCCATTATTTCTCGAGAAATAATGGCAGTCACTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-1442s1c1
Sequence:CCGGCCCAAGGAAAGGCATCCTTAACTCGAGTTAAGGATGCCTTTCCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-503s1c1
Sequence:CCGGCCGAGGCGATCTGTATGATTACTCGAGTAATCATACAGATCGCCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-1323s1c1
Sequence:CCGGCCGAAAGGCATTCTCAAGAAACTCGAGTTTCTTGAGAATGCCTTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028778
NUAK2 MISSION shRNA shRNA Plasmid DNA
NUAK family, SNF1-like kinase, 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028778.3-180s21c1
Sequence:CCGGGGGCTCATCAAGTCGCCTAAACTCGAGTTTAGGCGACTTGATGAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028778.3-852s21c1
Sequence:CCGGTTTGACGGGCAGGATCATAAACTCGAGTTTATGATCCTGCCCGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028778.3-1463s21c1
Sequence:CCGGGAAGTCTCGACAGCGTGAATCCTCGAGGATTCACGCTGTCGAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-191s1c1
Sequence:CCGGGTCGCCTAAACCTCTGATGAACTCGAGTTCATCAGAGGTTTAGGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-657s1c1
Sequence:CCGGGCCAATGGAAACATCAAGATTCTCGAGAATCTTGATGTTTCCATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028778.3-2321s21c1
Sequence:CCGGGTGTAGTGACTGCCATTATTTCTCGAGAAATAATGGCAGTCACTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-1442s1c1
Sequence:CCGGCCCAAGGAAAGGCATCCTTAACTCGAGTTAAGGATGCCTTTCCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-503s1c1
Sequence:CCGGCCGAGGCGATCTGTATGATTACTCGAGTAATCATACAGATCGCCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-1323s1c1
Sequence:CCGGCCGAAAGGCATTCTCAAGAAACTCGAGTTTCTTGAGAATGCCTTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028778
NUAK2 MISSION shRNA Lentiviral Transduction Particles
NUAK family, SNF1-like kinase, 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028778.3-180s21c1
Sequence:CCGGGGGCTCATCAAGTCGCCTAAACTCGAGTTTAGGCGACTTGATGAGCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028778.3-852s21c1
Sequence:CCGGTTTGACGGGCAGGATCATAAACTCGAGTTTATGATCCTGCCCGTCAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028778.3-1463s21c1
Sequence:CCGGGAAGTCTCGACAGCGTGAATCCTCGAGGATTCACGCTGTCGAGACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-191s1c1
Sequence:CCGGGTCGCCTAAACCTCTGATGAACTCGAGTTCATCAGAGGTTTAGGCGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-657s1c1
Sequence:CCGGGCCAATGGAAACATCAAGATTCTCGAGAATCTTGATGTTTCCATTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028778.3-2321s21c1
Sequence:CCGGGTGTAGTGACTGCCATTATTTCTCGAGAAATAATGGCAGTCACTACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-1442s1c1
Sequence:CCGGCCCAAGGAAAGGCATCCTTAACTCGAGTTAAGGATGCCTTTCCTTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-503s1c1
Sequence:CCGGCCGAGGCGATCTGTATGATTACTCGAGTAATCATACAGATCGCCTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028778.2-1323s1c1
Sequence:CCGGCCGAAAGGCATTCTCAAGAAACTCGAGTTTCTTGAGAATGCCTTTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)