EMAIL THIS PAGE TO A FRIEND

NUB1

negative regulator of ubiquitin-like proteins 1

119 Gene Product Result for
Synonyms: BS4 NUB1L NYREN18
UniProtKB ID: Q9Y5A7, O95422, Q75MR9, Q8IX22, Q9BXR2
Gene ID:
Human(51667) Summary: This gene encodes a protein that functions as a negative regulator of NEDD8, a ubiquitin-like protein that conjugates with cullin family members in order to regulate vital biological events. The protein encoded by this gene regulates the NEDD8 conjugation system post-transcriptionally by recruiting NEDD8 and its conjugates to the proteasome for degradation. This protein interacts with the product of the AIPL1 gene, which is associated with Leber congenital amaurosis, an inherited retinopathy, and mutations in that gene can abolish interaction with this protein, which may contribute to the pathogenesis. This protein is also known to accumulate in Lewy bodies in Parkinson's disease and dementia with Lewy bodies, and in glial cytoplasmic inclusions in multiple system atrophy, with this abnormal accumulation being specific to alpha-synucleinopathy lesions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(53312) negative regulator of ubiquitin-like proteins 1
Rat(296731) negative regulator of ubiquitin-like proteins 1
Zebrafish(557021) negative regulator of ubiquitin-like proteins 1
cow(511298) negative regulator of ubiquitin-like proteins 1
Horse(100063567) negative regulator of ubiquitin-like proteins 1
domestic cat(101099625) negative regulator of ubiquitin-like proteins 1
dog(475542) negative regulator of ubiquitin-like proteins 1
chicken(420433) negative regulator of ubiquitin-like proteins 1
sheep(101104058) negative regulator of ubiquitin-like proteins 1
domestic guinea pig(100714758) negative regulator of ubiquitin-like proteins 1
Domestic Rabbit(100346290) negative regulator of ubiquitin-like proteins 1
naked mole-rat(101702480) negative regulator of ubiquitin-like proteins 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N0539 Anti-NUB1 (611-625) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA050722 Anti-NUB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA021220 Anti-NUB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA053648 Anti-NUB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1300292 Anti-NYREN18 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300075 Anti-NYREN18 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4502159 Anti-NYREN18 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1307085 ANTI-NYREN18(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1307084 ANTI-NYREN18(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016118 Rosetta Predictions human pricing
NM_001013925 Rosetta Predictions rat pricing
XM_001060617 Rosetta Predictions rat pricing
NM_016736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179115 predicted 1281
2 SASI_Hs01_00179116 predicted 256
3 SASI_Hs01_00179118 predicted 635
4 SASI_Hs01_00179119 predicted 1930
5 SASI_Hs01_00179120 predicted 642
6 SASI_Hs01_00179121 predicted 1766
7 SASI_Hs01_00179122 predicted 316
8 SASI_Hs01_00179123 predicted 473
9 SASI_Hs01_00179124 predicted 557
10 SASI_Hs02_00348887 predicted 583
11 SASI_Hs01_00179117 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037538 predicted 1205
2 SASI_Rn01_00037539 predicted 1416
3 SASI_Rn01_00037541 predicted 719
4 SASI_Rn01_00037542 predicted 1209
5 SASI_Rn01_00037543 predicted 276
6 SASI_Rn02_00201219 predicted 1111
7 SASI_Rn01_00037545 predicted 462
8 SASI_Rn01_00037546 predicted 1878
9 SASI_Rn01_00037547 predicted 411
10 SASI_Rn02_00201220 predicted 1502
11 SASI_Rn01_00037540 predicted 1088
12 SASI_Rn01_00037544 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297173 predicted 1388
2 SASI_Rn02_00297174 predicted 372
3 SASI_Rn02_00297175 predicted 905
4 SASI_Rn02_00297176 predicted 1400
5 SASI_Rn02_00297177 predicted 347
6 SASI_Rn02_00297178 predicted 337
7 SASI_Rn02_00297179 predicted 458
8 SASI_Rn02_00297180 predicted 1314
9 SASI_Rn02_00297181 predicted 1297
10 SASI_Rn02_00297182 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134310 predicted 846
2 SASI_Mm02_00323432 predicted 1082
3 SASI_Mm01_00134311 predicted 315
4 SASI_Mm02_00323433 predicted 1198
5 SASI_Mm01_00134313 predicted 1546
6 SASI_Mm01_00134314 predicted 403
7 SASI_Mm02_00323434 predicted 2089
8 SASI_Mm01_00134315 predicted 282
9 SASI_Mm02_00323435 predicted 2076
10 SASI_Mm01_00134318 predicted 1067
11 SASI_Mm01_00134312 predicted 944
12 SASI_Mm01_00134316 predicted 2075
13 SASI_Mm01_00134317 predicted 629
14 SASI_Mm01_00134319 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016118
VALIDATED
NUB1 MISSION shRNA Bacterial Glycerol Stock
negative regulator of ubiquitin-like proteins 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016118.x-696s1c1
Sequence:CCGGCCAGAAATGACACCGTACTTACTCGAGTAAGTACGGTGTCATTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016118.3-1945s21c1
Sequence:CCGGTGCAGCTCTTTCTGTTCTTACCTCGAGGTAAGAACAGAAAGAGCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016118.x-2823s1c1
Sequence:CCGGGCCACGCACTCCTCTGTAGATCTCGAGATCTACAGAGGAGTGCGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016118.x-1446s1c1
Sequence:CCGGCCTCAGATGTGGTGGTTAAATCTCGAGATTTAACCACCACATCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016118.x-1135s1c1
Sequence:CCGGGTGGAAATGATGTAGAGGCTTCTCGAGAAGCCTCTACATCATTTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016118.x-929s1c1
Sequence:CCGGGCTGGATATAGTGTGGTGTTACTCGAGTAACACCACACTATATCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016118.3-1889s21c1
Sequence:CCGGGAACAGAAATAGCGCTAATTTCTCGAGAAATTAGCGCTATTTCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-304s21c1
Sequence:CCGGATTATAGAACAACGGGAATTGCTCGAGCAATTCCCGTTGTTCTATAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-1291s21c1
Sequence:CCGGATCATGCGGCCACTCATATTACTCGAGTAATATGAGTGGCCGCATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-533s21c1
Sequence:CCGGAGCGATGGTGCTTGAACTAAACTCGAGTTTAGTTCAAGCACCATCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016118.3-1973s21c1
Sequence:CCGGCTGAATTACAAGTCCTCTTTGCTCGAGCAAAGAGGACTTGTAATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-1111s21c1
Sequence:CCGGTTCAAGGGATCCGAAACTATCCTCGAGGATAGTTTCGGATCCCTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016118
VALIDATED
NUB1 MISSION shRNA shRNA Plasmid DNA
negative regulator of ubiquitin-like proteins 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016118.x-696s1c1
Sequence:CCGGCCAGAAATGACACCGTACTTACTCGAGTAAGTACGGTGTCATTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016118.3-1945s21c1
Sequence:CCGGTGCAGCTCTTTCTGTTCTTACCTCGAGGTAAGAACAGAAAGAGCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016118.x-2823s1c1
Sequence:CCGGGCCACGCACTCCTCTGTAGATCTCGAGATCTACAGAGGAGTGCGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016118.x-1446s1c1
Sequence:CCGGCCTCAGATGTGGTGGTTAAATCTCGAGATTTAACCACCACATCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016118.x-1135s1c1
Sequence:CCGGGTGGAAATGATGTAGAGGCTTCTCGAGAAGCCTCTACATCATTTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016118.x-929s1c1
Sequence:CCGGGCTGGATATAGTGTGGTGTTACTCGAGTAACACCACACTATATCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016118.3-1889s21c1
Sequence:CCGGGAACAGAAATAGCGCTAATTTCTCGAGAAATTAGCGCTATTTCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-304s21c1
Sequence:CCGGATTATAGAACAACGGGAATTGCTCGAGCAATTCCCGTTGTTCTATAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-1291s21c1
Sequence:CCGGATCATGCGGCCACTCATATTACTCGAGTAATATGAGTGGCCGCATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-533s21c1
Sequence:CCGGAGCGATGGTGCTTGAACTAAACTCGAGTTTAGTTCAAGCACCATCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016118.3-1973s21c1
Sequence:CCGGCTGAATTACAAGTCCTCTTTGCTCGAGCAAAGAGGACTTGTAATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-1111s21c1
Sequence:CCGGTTCAAGGGATCCGAAACTATCCTCGAGGATAGTTTCGGATCCCTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016118
VALIDATED
NUB1 MISSION shRNA Lentiviral Transduction Particles
negative regulator of ubiquitin-like proteins 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016118.x-696s1c1
Sequence:CCGGCCAGAAATGACACCGTACTTACTCGAGTAAGTACGGTGTCATTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016118.3-1945s21c1
Sequence:CCGGTGCAGCTCTTTCTGTTCTTACCTCGAGGTAAGAACAGAAAGAGCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016118.x-2823s1c1
Sequence:CCGGGCCACGCACTCCTCTGTAGATCTCGAGATCTACAGAGGAGTGCGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016118.x-1446s1c1
Sequence:CCGGCCTCAGATGTGGTGGTTAAATCTCGAGATTTAACCACCACATCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016118.x-1135s1c1
Sequence:CCGGGTGGAAATGATGTAGAGGCTTCTCGAGAAGCCTCTACATCATTTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016118.x-929s1c1
Sequence:CCGGGCTGGATATAGTGTGGTGTTACTCGAGTAACACCACACTATATCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016118.3-1889s21c1
Sequence:CCGGGAACAGAAATAGCGCTAATTTCTCGAGAAATTAGCGCTATTTCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-304s21c1
Sequence:CCGGATTATAGAACAACGGGAATTGCTCGAGCAATTCCCGTTGTTCTATAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-1291s21c1
Sequence:CCGGATCATGCGGCCACTCATATTACTCGAGTAATATGAGTGGCCGCATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-533s21c1
Sequence:CCGGAGCGATGGTGCTTGAACTAAACTCGAGTTTAGTTCAAGCACCATCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016118.3-1973s21c1
Sequence:CCGGCTGAATTACAAGTCCTCTTTGCTCGAGCAAAGAGGACTTGTAATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016118.3-1111s21c1
Sequence:CCGGTTCAAGGGATCCGAAACTATCCTCGAGGATAGTTTCGGATCCCTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016736
VALIDATED
NUB1 MISSION shRNA Bacterial Glycerol Stock
negative regulator of ubiquitin-like proteins 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-1924s21c1
Sequence:CCGGACGGAGGCTGTCAACGAAATCCTCGAGGATTTCGTTGACAGCCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-841s21c1
Sequence:CCGGCCGGAAACGATGCCTTACTTACTCGAGTAAGTAAGGCATCGTTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016736.1-2859s1c1
Sequence:CCGGCCTGAGATTGTGATCTGCTTTCTCGAGAAAGCAGATCACAATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-866s1c1
Sequence:CCGGCCGGAAACGATGCCTTACTTACTCGAGTAAGTAAGGCATCGTTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-2052s1c1
Sequence:CCGGCCTACGTTGAAAGTATAAGTTCTCGAGAACTTATACTTTCAACGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-599s1c1
Sequence:CCGGGCTGAAACTTTCGGATTTCAACTCGAGTTGAAATCCGAAAGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-2039s1c1
Sequence:CCGGGCTGAATACTTGTCCTACGTTCTCGAGAACGTAGGACAAGTATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-574s21c1
Sequence:CCGGGCTGAAACTTTCGGATTTCAACTCGAGTTGAAATCCGAAAGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-2014s21c1
Sequence:CCGGGCTGAATACTTGTCCTACGTTCTCGAGAACGTAGGACAAGTATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-2078s21c1
Sequence:CCGGGTGCTACGTTTCGGCTATAAACTCGAGTTTATAGCCGAAACGTAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016736
VALIDATED
NUB1 MISSION shRNA shRNA Plasmid DNA
negative regulator of ubiquitin-like proteins 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-1924s21c1
Sequence:CCGGACGGAGGCTGTCAACGAAATCCTCGAGGATTTCGTTGACAGCCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-841s21c1
Sequence:CCGGCCGGAAACGATGCCTTACTTACTCGAGTAAGTAAGGCATCGTTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016736.1-2859s1c1
Sequence:CCGGCCTGAGATTGTGATCTGCTTTCTCGAGAAAGCAGATCACAATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-866s1c1
Sequence:CCGGCCGGAAACGATGCCTTACTTACTCGAGTAAGTAAGGCATCGTTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-2052s1c1
Sequence:CCGGCCTACGTTGAAAGTATAAGTTCTCGAGAACTTATACTTTCAACGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-599s1c1
Sequence:CCGGGCTGAAACTTTCGGATTTCAACTCGAGTTGAAATCCGAAAGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-2039s1c1
Sequence:CCGGGCTGAATACTTGTCCTACGTTCTCGAGAACGTAGGACAAGTATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-574s21c1
Sequence:CCGGGCTGAAACTTTCGGATTTCAACTCGAGTTGAAATCCGAAAGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-2014s21c1
Sequence:CCGGGCTGAATACTTGTCCTACGTTCTCGAGAACGTAGGACAAGTATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-2078s21c1
Sequence:CCGGGTGCTACGTTTCGGCTATAAACTCGAGTTTATAGCCGAAACGTAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016736
VALIDATED
NUB1 MISSION shRNA Lentiviral Transduction Particles
negative regulator of ubiquitin-like proteins 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-1924s21c1
Sequence:CCGGACGGAGGCTGTCAACGAAATCCTCGAGGATTTCGTTGACAGCCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-841s21c1
Sequence:CCGGCCGGAAACGATGCCTTACTTACTCGAGTAAGTAAGGCATCGTTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016736.1-2859s1c1
Sequence:CCGGCCTGAGATTGTGATCTGCTTTCTCGAGAAAGCAGATCACAATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-866s1c1
Sequence:CCGGCCGGAAACGATGCCTTACTTACTCGAGTAAGTAAGGCATCGTTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-2052s1c1
Sequence:CCGGCCTACGTTGAAAGTATAAGTTCTCGAGAACTTATACTTTCAACGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-599s1c1
Sequence:CCGGGCTGAAACTTTCGGATTTCAACTCGAGTTGAAATCCGAAAGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016736.1-2039s1c1
Sequence:CCGGGCTGAATACTTGTCCTACGTTCTCGAGAACGTAGGACAAGTATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-574s21c1
Sequence:CCGGGCTGAAACTTTCGGATTTCAACTCGAGTTGAAATCCGAAAGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-2014s21c1
Sequence:CCGGGCTGAATACTTGTCCTACGTTCTCGAGAACGTAGGACAAGTATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016736.2-2078s21c1
Sequence:CCGGGTGCTACGTTTCGGCTATAAACTCGAGTTTATAGCCGAAACGTAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)