EMAIL THIS PAGE TO A FRIEND

NUBP1

nucleotide binding protein 1

53 Gene Product Result for
Synonyms: NBP NBP1
UniProtKB ID: P53384, Q32M30, Q498A9, Q53FS7
Gene ID:
Human(4682) Summary: NUBP1 is a member of the NUBP/MRP subfamily of ATP-binding proteins (Nakashima et al., 1999 [PubMed 10486206]
Mouse(26425) nucleotide binding protein 1
Rat(287042) nucleotide binding protein 1
naked mole-rat(101718088) nucleotide binding protein 1
domestic guinea pig(100725786) nucleotide binding protein 1
sheep(101108182) nucleotide binding protein 1
Zebrafish(503919) nucleotide binding protein 1 (MinD homolog, E. coli)
cow(507007) nucleotide binding protein 1
domestic cat(101085091) nucleotide binding protein 1
dog(479850) nucleotide binding protein 1
chicken(416634) nucleotide binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002484 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002484 Rosetta Predictions human pricing
NM_001009619 Rosetta Predictions rat pricing
NM_011955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196160 predicted 281
2 SASI_Hs01_00196162 predicted 988
3 SASI_Hs02_00333916 predicted 279
4 SASI_Hs01_00196164 predicted 309
5 SASI_Hs01_00196165 predicted 274
6 SASI_Hs01_00196167 predicted 776
7 SASI_Hs01_00196168 predicted 972
8 SASI_Hs01_00196169 predicted 747
9 SASI_Hs02_00333917 predicted 993
10 SASI_Hs02_00333918 predicted 713
11 SASI_Hs01_00196161 predicted 883
12 SASI_Hs01_00196163 predicted 886
13 SASI_Hs01_00196166 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035471 predicted 478
2 SASI_Rn01_00035472 predicted 653
3 SASI_Rn01_00035473 predicted 335
4 SASI_Rn01_00035475 predicted 683
5 SASI_Rn01_00035477 predicted 795
6 SASI_Rn01_00035478 predicted 207
7 SASI_Rn01_00035479 predicted 509
8 SASI_Rn01_00035480 predicted 272
9 SASI_Rn02_00199621 predicted 349
10 SASI_Rn02_00199622 predicted 649
11 SASI_Rn01_00035474 predicted 859
12 SASI_Rn01_00035476 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114541 predicted 319
2 SASI_Mm01_00114542 predicted 368
3 SASI_Mm01_00114543 predicted 897
4 SASI_Mm02_00321819 predicted 270
5 SASI_Mm01_00114544 predicted 896
6 SASI_Mm01_00114546 predicted 295
7 SASI_Mm01_00114547 predicted 193
8 SASI_Mm01_00114548 predicted 943
9 SASI_Mm01_00114549 predicted 262
10 SASI_Mm01_00114550 predicted 308
11 SASI_Mm01_00114545 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002484
NUBP1 MISSION shRNA Bacterial Glycerol Stock
nucleotide binding protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002484.2-834s21c1
Sequence:CCGGCCGCTCATAGGTAAGAATTGTCTCGAGACAATTCTTACCTATGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-815s1c1
Sequence:CCGGCCGCTCATAGGTAAGAATTGTCTCGAGACAATTCTTACCTATGAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-302s1c1
Sequence:CCGGCCCAAGATAATGGGATTGGAACTCGAGTTCCAATCCCATTATCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-812s1c1
Sequence:CCGGGATCCGCTCATAGGTAAGAATCTCGAGATTCTTACCTATGAGCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002484.2-989s21c1
Sequence:CCGGCGAGAGAATGTTCAGGACCAACTCGAGTTGGTCCTGAACATTCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002484.2-285s21c1
Sequence:CCGGGCTCTTCTAGACATCGATATACTCGAGTATATCGATGTCTAGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-266s1c1
Sequence:CCGGGCTCTTCTAGACATCGATATACTCGAGTATATCGATGTCTAGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-970s1c1
Sequence:CCGGCGAGAGAATGTTCAGGACCAACTCGAGTTGGTCCTGAACATTCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-820s1c1
Sequence:CCGGCATAGGTAAGAATTGTGACAACTCGAGTTGTCACAATTCTTACCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002484.2-321s21c1
Sequence:CCGGCCCAAGATAATGGGATTGGAACTCGAGTTCCAATCCCATTATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-298s1c1
Sequence:CCGGGATTCCCAAGATAATGGGATTCTCGAGAATCCCATTATCTTGGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002484
NUBP1 MISSION shRNA shRNA Plasmid DNA
nucleotide binding protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002484.2-834s21c1
Sequence:CCGGCCGCTCATAGGTAAGAATTGTCTCGAGACAATTCTTACCTATGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-815s1c1
Sequence:CCGGCCGCTCATAGGTAAGAATTGTCTCGAGACAATTCTTACCTATGAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-302s1c1
Sequence:CCGGCCCAAGATAATGGGATTGGAACTCGAGTTCCAATCCCATTATCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-812s1c1
Sequence:CCGGGATCCGCTCATAGGTAAGAATCTCGAGATTCTTACCTATGAGCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002484.2-989s21c1
Sequence:CCGGCGAGAGAATGTTCAGGACCAACTCGAGTTGGTCCTGAACATTCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002484.2-285s21c1
Sequence:CCGGGCTCTTCTAGACATCGATATACTCGAGTATATCGATGTCTAGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-266s1c1
Sequence:CCGGGCTCTTCTAGACATCGATATACTCGAGTATATCGATGTCTAGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-970s1c1
Sequence:CCGGCGAGAGAATGTTCAGGACCAACTCGAGTTGGTCCTGAACATTCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-820s1c1
Sequence:CCGGCATAGGTAAGAATTGTGACAACTCGAGTTGTCACAATTCTTACCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002484.2-321s21c1
Sequence:CCGGCCCAAGATAATGGGATTGGAACTCGAGTTCCAATCCCATTATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-298s1c1
Sequence:CCGGGATTCCCAAGATAATGGGATTCTCGAGAATCCCATTATCTTGGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002484
NUBP1 MISSION shRNA Lentiviral Transduction Particles
nucleotide binding protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002484.2-834s21c1
Sequence:CCGGCCGCTCATAGGTAAGAATTGTCTCGAGACAATTCTTACCTATGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-815s1c1
Sequence:CCGGCCGCTCATAGGTAAGAATTGTCTCGAGACAATTCTTACCTATGAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-302s1c1
Sequence:CCGGCCCAAGATAATGGGATTGGAACTCGAGTTCCAATCCCATTATCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-812s1c1
Sequence:CCGGGATCCGCTCATAGGTAAGAATCTCGAGATTCTTACCTATGAGCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002484.2-989s21c1
Sequence:CCGGCGAGAGAATGTTCAGGACCAACTCGAGTTGGTCCTGAACATTCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002484.2-285s21c1
Sequence:CCGGGCTCTTCTAGACATCGATATACTCGAGTATATCGATGTCTAGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-266s1c1
Sequence:CCGGGCTCTTCTAGACATCGATATACTCGAGTATATCGATGTCTAGAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-970s1c1
Sequence:CCGGCGAGAGAATGTTCAGGACCAACTCGAGTTGGTCCTGAACATTCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-820s1c1
Sequence:CCGGCATAGGTAAGAATTGTGACAACTCGAGTTGTCACAATTCTTACCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002484.2-321s21c1
Sequence:CCGGCCCAAGATAATGGGATTGGAACTCGAGTTCCAATCCCATTATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002484.1-298s1c1
Sequence:CCGGGATTCCCAAGATAATGGGATTCTCGAGAATCCCATTATCTTGGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011955
VALIDATED
NUBP1 MISSION shRNA Bacterial Glycerol Stock
nucleotide binding protein 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011955.1-1086s21c1
Sequence:CCGGCAGGATTTGAAGTCACTCATTCTCGAGAATGAGTGACTTCAAATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011955.1-785s21c1
Sequence:CCGGCAGGATCTGAGGATTCCACTTCTCGAGAAGTGGAATCCTCAGATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-904s1c1
Sequence:CCGGCAGAAGTATAATTCAGAGGATCTCGAGATCCTCTGAATTATACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-142s1c1
Sequence:CCGGCGTGGAGGAAATCAGAGAGAACTCGAGTTCTCTCTGATTTCCTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-785s1c1
Sequence:CCGGCAGGATCTGAGGATTCCACTTCTCGAGAAGTGGAATCCTCAGATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011955.1-314s1c1
Sequence:CCGGCCCAAGATCATGGGCTTAGAACTCGAGTTCTAAGCCCATGATCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011955.1-257s21c1
Sequence:CCGGGAGGATGGAGATACACAGGTTCTCGAGAACCTGTGTATCTCCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011955.1-142s21c1
Sequence:CCGGCGTGGAGGAAATCAGAGAGAACTCGAGTTCTCTCTGATTTCCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011955.1-163s1c1
Sequence:CCGGGATGAAGACGGTGAGACACAACTCGAGTTGTGTCTCACCGTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-1086s1c1
Sequence:CCGGCAGGATTTGAAGTCACTCATTCTCGAGAATGAGTGACTTCAAATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-257s1c1
Sequence:CCGGGAGGATGGAGATACACAGGTTCTCGAGAACCTGTGTATCTCCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011955.1-371s1c1
Sequence:CCGGCCAGTGTACGTGGATGACAATCTCGAGATTGTCATCCACGTACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011955
VALIDATED
NUBP1 MISSION shRNA shRNA Plasmid DNA
nucleotide binding protein 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011955.1-1086s21c1
Sequence:CCGGCAGGATTTGAAGTCACTCATTCTCGAGAATGAGTGACTTCAAATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011955.1-785s21c1
Sequence:CCGGCAGGATCTGAGGATTCCACTTCTCGAGAAGTGGAATCCTCAGATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-904s1c1
Sequence:CCGGCAGAAGTATAATTCAGAGGATCTCGAGATCCTCTGAATTATACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-142s1c1
Sequence:CCGGCGTGGAGGAAATCAGAGAGAACTCGAGTTCTCTCTGATTTCCTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-785s1c1
Sequence:CCGGCAGGATCTGAGGATTCCACTTCTCGAGAAGTGGAATCCTCAGATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011955.1-314s1c1
Sequence:CCGGCCCAAGATCATGGGCTTAGAACTCGAGTTCTAAGCCCATGATCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011955.1-257s21c1
Sequence:CCGGGAGGATGGAGATACACAGGTTCTCGAGAACCTGTGTATCTCCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011955.1-142s21c1
Sequence:CCGGCGTGGAGGAAATCAGAGAGAACTCGAGTTCTCTCTGATTTCCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011955.1-163s1c1
Sequence:CCGGGATGAAGACGGTGAGACACAACTCGAGTTGTGTCTCACCGTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-1086s1c1
Sequence:CCGGCAGGATTTGAAGTCACTCATTCTCGAGAATGAGTGACTTCAAATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-257s1c1
Sequence:CCGGGAGGATGGAGATACACAGGTTCTCGAGAACCTGTGTATCTCCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011955.1-371s1c1
Sequence:CCGGCCAGTGTACGTGGATGACAATCTCGAGATTGTCATCCACGTACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011955
VALIDATED
NUBP1 MISSION shRNA Lentiviral Transduction Particles
nucleotide binding protein 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011955.1-1086s21c1
Sequence:CCGGCAGGATTTGAAGTCACTCATTCTCGAGAATGAGTGACTTCAAATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011955.1-785s21c1
Sequence:CCGGCAGGATCTGAGGATTCCACTTCTCGAGAAGTGGAATCCTCAGATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-904s1c1
Sequence:CCGGCAGAAGTATAATTCAGAGGATCTCGAGATCCTCTGAATTATACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-142s1c1
Sequence:CCGGCGTGGAGGAAATCAGAGAGAACTCGAGTTCTCTCTGATTTCCTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-785s1c1
Sequence:CCGGCAGGATCTGAGGATTCCACTTCTCGAGAAGTGGAATCCTCAGATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011955.1-314s1c1
Sequence:CCGGCCCAAGATCATGGGCTTAGAACTCGAGTTCTAAGCCCATGATCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011955.1-257s21c1
Sequence:CCGGGAGGATGGAGATACACAGGTTCTCGAGAACCTGTGTATCTCCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011955.1-142s21c1
Sequence:CCGGCGTGGAGGAAATCAGAGAGAACTCGAGTTCTCTCTGATTTCCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011955.1-163s1c1
Sequence:CCGGGATGAAGACGGTGAGACACAACTCGAGTTGTGTCTCACCGTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-1086s1c1
Sequence:CCGGCAGGATTTGAAGTCACTCATTCTCGAGAATGAGTGACTTCAAATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011955.1-257s1c1
Sequence:CCGGGAGGATGGAGATACACAGGTTCTCGAGAACCTGTGTATCTCCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011955.1-371s1c1
Sequence:CCGGCCAGTGTACGTGGATGACAATCTCGAGATTGTCATCCACGTACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)