EMAIL THIS PAGE TO A FRIEND

NUBP2

nucleotide binding protein 2

65 Gene Product Result for
Synonyms: CFD1 NUBP1
UniProtKB ID: Q9Y5Y2, D3DU80, Q9NWB2
Gene ID:
Human(10101) Summary: NUBP2 is a member of the NUBP/MRP gene subfamily of ATP-binding proteins (see NUBP1; MIM 600280) (Nakashima et al., 1999 [PubMed 10486206]
Mouse(26426) nucleotide binding protein 2
Rat(287125) nucleotide binding protein 2
Zebrafish(641290) nucleotide binding protein 2 (MinD homolog, E. coli)
chicken(416402) nucleotide binding protein 2
cow(515660) nucleotide binding protein 2
domestic cat(101085771) nucleotide binding protein 2
dog(609980) nucleotide binding protein 2
sheep(101112869) nucleotide binding protein 2
domestic guinea pig(100729581) nucleotide binding protein 2
naked mole-rat(101696763) nucleotide binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012225 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012225 Rosetta Predictions human pricing
NM_001011891 Rosetta Predictions rat pricing
XM_573056 Rosetta Predictions rat pricing
NM_011956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029860 predicted 636
2 SASI_Hs01_00029861 predicted 610
3 SASI_Hs01_00029862 predicted 575
4 SASI_Hs01_00029863 predicted 581
5 SASI_Hs01_00029864 predicted 399
6 SASI_Hs01_00029865 predicted 306
7 SASI_Hs01_00029866 predicted 897
8 SASI_Hs01_00029867 predicted 316
9 SASI_Hs01_00029868 predicted 609
10 SASI_Hs02_00343902 predicted 822
11 SASI_Hs01_00029869 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054451 predicted 787
2 SASI_Rn01_00054452 predicted 1163
3 SASI_Rn01_00054453 predicted 957
4 SASI_Rn01_00054454 predicted 960
5 SASI_Rn01_00054455 predicted 1055
6 SASI_Rn01_00054456 predicted 502
7 SASI_Rn01_00054457 predicted 1048
8 SASI_Rn01_00054458 predicted 990
9 SASI_Rn01_00054459 predicted 270
10 SASI_Rn01_00054460 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189927 predicted 824
2 SASI_Rn01_00189928 predicted 1192
3 SASI_Rn01_00189929 predicted 997
4 SASI_Rn01_00189930 predicted 999
5 SASI_Rn01_00189931 predicted 1089
6 SASI_Rn01_00189932 predicted 533
7 SASI_Rn01_00189933 predicted 1093
8 SASI_Rn01_00189934 predicted 1029
9 SASI_Rn01_00189935 predicted 305
10 SASI_Rn01_00189936 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321820 predicted 1082
2 SASI_Mm02_00321821 predicted 1105
3 SASI_Mm02_00321822 predicted 1095
4 SASI_Mm02_00321823 predicted 1072
5 SASI_Mm02_00321824 predicted 959
6 SASI_Mm02_00321825 predicted 230
7 SASI_Mm02_00321826 predicted 1071
8 SASI_Mm02_00321827 predicted 899
9 SASI_Mm02_00321828 predicted 306
10 SASI_Mm02_00321829 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011956
VALIDATED
NUBP2 MISSION shRNA Bacterial Glycerol Stock
nucleotide binding protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-776s21c1
Sequence:CCGGGTGACTTCATCCAGGAATTTCCTCGAGGAAATTCCTGGATGAAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-306s21c1
Sequence:CCGGGGAGCAGAGCATCTCCCTTATCTCGAGATAAGGGAGATGCTCTGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-472s21c1
Sequence:CCGGGATGAGCACATGGCCACTATGCTCGAGCATAGTGGCCATGTGCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-812s21c1
Sequence:CCGGATTCCGCACTCACGTCCATAGCTCGAGCTATGGACGTGAGTGCGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-1099s21c1
Sequence:CCGGGCCTTAACCTTTAGCCTATAGCTCGAGCTATAGGCTAAAGGTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011956.2-1096s1c1
Sequence:CCGGGCAGCCTTAACCTTTAGCCTACTCGAGTAGGCTAAAGGTTAAGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011956.2-94s1c1
Sequence:CCGGGTGCGACACATCATCCTTGTTCTCGAGAACAAGGATGATGTGTCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011956.2-432s1c1
Sequence:CCGGGCTGGATTATCTGGTTGTGGACTCGAGTCCACAACCAGATAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011956
VALIDATED
NUBP2 MISSION shRNA shRNA Plasmid DNA
nucleotide binding protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-776s21c1
Sequence:CCGGGTGACTTCATCCAGGAATTTCCTCGAGGAAATTCCTGGATGAAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-306s21c1
Sequence:CCGGGGAGCAGAGCATCTCCCTTATCTCGAGATAAGGGAGATGCTCTGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-472s21c1
Sequence:CCGGGATGAGCACATGGCCACTATGCTCGAGCATAGTGGCCATGTGCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-812s21c1
Sequence:CCGGATTCCGCACTCACGTCCATAGCTCGAGCTATGGACGTGAGTGCGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-1099s21c1
Sequence:CCGGGCCTTAACCTTTAGCCTATAGCTCGAGCTATAGGCTAAAGGTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011956.2-1096s1c1
Sequence:CCGGGCAGCCTTAACCTTTAGCCTACTCGAGTAGGCTAAAGGTTAAGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011956.2-94s1c1
Sequence:CCGGGTGCGACACATCATCCTTGTTCTCGAGAACAAGGATGATGTGTCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011956.2-432s1c1
Sequence:CCGGGCTGGATTATCTGGTTGTGGACTCGAGTCCACAACCAGATAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011956
VALIDATED
NUBP2 MISSION shRNA Lentiviral Transduction Particles
nucleotide binding protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-776s21c1
Sequence:CCGGGTGACTTCATCCAGGAATTTCCTCGAGGAAATTCCTGGATGAAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-306s21c1
Sequence:CCGGGGAGCAGAGCATCTCCCTTATCTCGAGATAAGGGAGATGCTCTGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-472s21c1
Sequence:CCGGGATGAGCACATGGCCACTATGCTCGAGCATAGTGGCCATGTGCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-812s21c1
Sequence:CCGGATTCCGCACTCACGTCCATAGCTCGAGCTATGGACGTGAGTGCGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011956.2-1099s21c1
Sequence:CCGGGCCTTAACCTTTAGCCTATAGCTCGAGCTATAGGCTAAAGGTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011956.2-1096s1c1
Sequence:CCGGGCAGCCTTAACCTTTAGCCTACTCGAGTAGGCTAAAGGTTAAGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011956.2-94s1c1
Sequence:CCGGGTGCGACACATCATCCTTGTTCTCGAGAACAAGGATGATGTGTCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011956.2-432s1c1
Sequence:CCGGGCTGGATTATCTGGTTGTGGACTCGAGTCCACAACCAGATAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012225
VALIDATED
NUBP2 MISSION shRNA Bacterial Glycerol Stock
nucleotide binding protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_012225.2-1143s21c1
Sequence:CCGGGGCTCTCTTCCCATCCATGTTCTCGAGAACATGGATGGGAAGAGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012225.2-508s21c1
Sequence:CCGGAGCACATGGCCACCATAGAAGCTCGAGCTTCTATGGTGGCCATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012225.2-640s21c1
Sequence:CCGGTGATGGGAATCGTGGAGAATACTCGAGTATTCTCCACGATTCCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012225.2-421s21c1
Sequence:CCGGACGCGCTGATAAAGCAGTTTGCTCGAGCAAACTGCTTTATCAGCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012225.2-340s21c1
Sequence:CCGGAGCAGAGCATCTCGCTCATGTCTCGAGACATGAGCGAGATGCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012225.1-399s1c1
Sequence:CCGGGCTGATAAAGCAGTTTGTGTCCTCGAGGACACAAACTGCTTTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012225.1-615s1c1
Sequence:CCGGGATGGGAATCGTGGAGAATATCTCGAGATATTCTCCACGATTCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012225
VALIDATED
NUBP2 MISSION shRNA shRNA Plasmid DNA
nucleotide binding protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_012225.2-1143s21c1
Sequence:CCGGGGCTCTCTTCCCATCCATGTTCTCGAGAACATGGATGGGAAGAGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012225.2-508s21c1
Sequence:CCGGAGCACATGGCCACCATAGAAGCTCGAGCTTCTATGGTGGCCATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012225.2-640s21c1
Sequence:CCGGTGATGGGAATCGTGGAGAATACTCGAGTATTCTCCACGATTCCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012225.2-421s21c1
Sequence:CCGGACGCGCTGATAAAGCAGTTTGCTCGAGCAAACTGCTTTATCAGCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012225.2-340s21c1
Sequence:CCGGAGCAGAGCATCTCGCTCATGTCTCGAGACATGAGCGAGATGCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012225.1-399s1c1
Sequence:CCGGGCTGATAAAGCAGTTTGTGTCCTCGAGGACACAAACTGCTTTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012225.1-615s1c1
Sequence:CCGGGATGGGAATCGTGGAGAATATCTCGAGATATTCTCCACGATTCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012225
VALIDATED
NUBP2 MISSION shRNA Lentiviral Transduction Particles
nucleotide binding protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_012225.2-1143s21c1
Sequence:CCGGGGCTCTCTTCCCATCCATGTTCTCGAGAACATGGATGGGAAGAGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012225.2-508s21c1
Sequence:CCGGAGCACATGGCCACCATAGAAGCTCGAGCTTCTATGGTGGCCATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012225.2-640s21c1
Sequence:CCGGTGATGGGAATCGTGGAGAATACTCGAGTATTCTCCACGATTCCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012225.2-421s21c1
Sequence:CCGGACGCGCTGATAAAGCAGTTTGCTCGAGCAAACTGCTTTATCAGCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012225.2-340s21c1
Sequence:CCGGAGCAGAGCATCTCGCTCATGTCTCGAGACATGAGCGAGATGCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012225.1-399s1c1
Sequence:CCGGGCTGATAAAGCAGTTTGTGTCCTCGAGGACACAAACTGCTTTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012225.1-615s1c1
Sequence:CCGGGATGGGAATCGTGGAGAATATCTCGAGATATTCTCCACGATTCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)