EMAIL THIS PAGE TO A FRIEND

NUBPL

nucleotide binding protein-like

100 Gene Product Result for
Synonyms: C14orf127 IND1 huInd1
UniProtKB ID: Q8TB37, B4DHZ1, Q86TZ4, Q9H9M2
Gene ID:
Human(80224) Summary: This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. The respiratory complex I consists of 45 subunits and 8 iron-sulfur (Fe/S) clusters. This protein is an Fe/S protein that plays a critical role in the assembly of respiratory complex I, likely by transferring Fe/S into the Fe/S-containing complex I subunits. Mutations in this gene cause mitochondrial complex I deficiency. Alternatively spliced transcript variants encoding distinct isoforms have been identified.[provided by RefSeq, Jan 2011]
Mouse(76826) nucleotide binding protein-like
Rat(299008) nucleotide binding protein-like
naked mole-rat(101697814) nucleotide binding protein-like
domestic guinea pig(100714920) nucleotide binding protein-like
sheep(101116606) nucleotide binding protein-like
Zebrafish(436715) nucleotide binding protein-like
dog(609340) nucleotide binding protein-like
chicken(423312) nucleotide binding protein-like
cow(614641) nucleotide binding protein-like
domestic cat(101088001) nucleotide binding protein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025152 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156711 MISSION® esiRNA esiRNA human NUBPL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025152 Rosetta Predictions human pricing
XM_001075426 Rosetta Predictions rat pricing
XM_216689 Rosetta Predictions rat pricing
NM_029760 Rosetta Predictions mouse pricing
XM_885240 Rosetta Predictions mouse pricing
XM_896046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357886 predicted 1135
2 SASI_Hs01_00225825 predicted 463
3 SASI_Hs02_00357887 predicted 239
4 SASI_Hs01_00225829 predicted 1149
5 SASI_Hs02_00357888 predicted 256
6 SASI_Hs02_00357889 predicted 247
7 SASI_Hs01_00225831 predicted 1149
8 SASI_Hs01_00225832 predicted 1171
9 SASI_Hs01_00225833 predicted 501
10 SASI_Hs01_00225834 predicted 390
11 SASI_Hs01_00225826 predicted 366
12 SASI_Hs01_00225827 predicted 268
13 SASI_Hs01_00225828 predicted 298
14 SASI_Hs01_00225830 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349673 predicted 455
2 SASI_Rn02_00349674 predicted 832
3 SASI_Rn02_00349675 predicted 410
4 SASI_Rn02_00349676 predicted 606
5 SASI_Rn02_00349677 predicted 212
6 SASI_Rn02_00349678 predicted 527
7 SASI_Rn02_00349679 predicted 924
8 SASI_Rn02_00349680 predicted 513
9 SASI_Rn02_00349681 predicted 495
10 SASI_Rn02_00349682 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376720 predicted 260
2 SASI_Rn02_00376721 predicted 260
3 SASI_Rn02_00376722 predicted 215
4 SASI_Rn02_00376723 predicted 220
5 SASI_Rn02_00376724 predicted 218
6 SASI_Rn02_00376725 predicted 229
7 SASI_Rn02_00376726 predicted 222
8 SASI_Rn02_00376727 predicted 196
9 SASI_Rn02_00376728 predicted 227
10 SASI_Rn02_00376729 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335889 predicted 213
2 SASI_Mm02_00335890 predicted 449
3 SASI_Mm02_00335891 predicted 927
4 SASI_Mm02_00335892 predicted 490
5 SASI_Mm02_00335893 predicted 885
6 SASI_Mm02_00335894 predicted 511
7 SASI_Mm02_00335895 predicted 525
8 SASI_Mm02_00335896 predicted 867
9 SASI_Mm02_00335897 predicted 440
10 SASI_Mm02_00335898 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264048 predicted 226
2 SASI_Mm01_00264049 predicted 464
3 SASI_Mm01_00264050 predicted 643
4 SASI_Mm01_00264051 predicted 454
5 SASI_Mm01_00264052 predicted 940
6 SASI_Mm01_00264053 predicted 500
7 SASI_Mm01_00264054 predicted 902
8 SASI_Mm01_00264055 predicted 530
9 SASI_Mm01_00264056 predicted 537
10 SASI_Mm01_00264057 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216480 predicted 229
2 SASI_Mm01_00216481 predicted 832
3 SASI_Mm01_00216482 predicted 694
4 SASI_Mm01_00216483 predicted 489
5 SASI_Mm01_00216484 predicted 451
6 SASI_Mm01_00216485 predicted 763
7 SASI_Mm01_00216486 predicted 366
8 SASI_Mm01_00216487 predicted 331
9 SASI_Mm01_00216488 predicted 461
10 SASI_Mm01_00216489 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025152
NUBPL MISSION shRNA Bacterial Glycerol Stock
nucleotide binding protein-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-221s1c1
Sequence:CCGGGCAGTGAATCTTGCACTTGCACTCGAGTGCAAGTGCAAGATTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025152.1-1686s1c1
Sequence:CCGGGCTTGGATTTGAACTTGAGTACTCGAGTACTCAAGTTCAAATCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-386s1c1
Sequence:CCGGGCTTGTATGTCTATGGGCTTTCTCGAGAAAGCCCATAGACATACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-866s1c1
Sequence:CCGGGCCAAAGCTTACTTGAGGATTCTCGAGAATCCTCAAGTAAGCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-541s1c1
Sequence:CCGGGCAGTTATCAGTCTCACAGAACTCGAGTTCTGTGAGACTGATAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025152.2-1275s21c1
Sequence:CCGGCCTTTAGAAATCACGAGTTTACTCGAGTAAACTCGTGATTTCTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025152.2-872s21c1
Sequence:CCGGGACATTCCCTTACACCTTAATCTCGAGATTAAGGTGTAAGGGAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025152
NUBPL MISSION shRNA shRNA Plasmid DNA
nucleotide binding protein-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-221s1c1
Sequence:CCGGGCAGTGAATCTTGCACTTGCACTCGAGTGCAAGTGCAAGATTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025152.1-1686s1c1
Sequence:CCGGGCTTGGATTTGAACTTGAGTACTCGAGTACTCAAGTTCAAATCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-386s1c1
Sequence:CCGGGCTTGTATGTCTATGGGCTTTCTCGAGAAAGCCCATAGACATACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-866s1c1
Sequence:CCGGGCCAAAGCTTACTTGAGGATTCTCGAGAATCCTCAAGTAAGCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-541s1c1
Sequence:CCGGGCAGTTATCAGTCTCACAGAACTCGAGTTCTGTGAGACTGATAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025152.2-1275s21c1
Sequence:CCGGCCTTTAGAAATCACGAGTTTACTCGAGTAAACTCGTGATTTCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025152.2-872s21c1
Sequence:CCGGGACATTCCCTTACACCTTAATCTCGAGATTAAGGTGTAAGGGAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025152
NUBPL MISSION shRNA Lentiviral Transduction Particles
nucleotide binding protein-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-221s1c1
Sequence:CCGGGCAGTGAATCTTGCACTTGCACTCGAGTGCAAGTGCAAGATTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025152.1-1686s1c1
Sequence:CCGGGCTTGGATTTGAACTTGAGTACTCGAGTACTCAAGTTCAAATCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-386s1c1
Sequence:CCGGGCTTGTATGTCTATGGGCTTTCTCGAGAAAGCCCATAGACATACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-866s1c1
Sequence:CCGGGCCAAAGCTTACTTGAGGATTCTCGAGAATCCTCAAGTAAGCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025152.1-541s1c1
Sequence:CCGGGCAGTTATCAGTCTCACAGAACTCGAGTTCTGTGAGACTGATAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025152.2-1275s21c1
Sequence:CCGGCCTTTAGAAATCACGAGTTTACTCGAGTAAACTCGTGATTTCTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025152.2-872s21c1
Sequence:CCGGGACATTCCCTTACACCTTAATCTCGAGATTAAGGTGTAAGGGAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029760
NUBPL MISSION shRNA Bacterial Glycerol Stock
nucleotide binding protein-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-936s21c1
Sequence:CCGGGCCAAAGCTTACCTGCATATTCTCGAGAATATGCAGGTAAGCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-450s21c1
Sequence:CCGGGGTATTGCTTGTATGTCAATGCTCGAGCATTGACATACAAGCAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-875s21c1
Sequence:CCGGTATAAGGGAAGCTTCGGATATCTCGAGATATCCGAAGCTTCCCTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-503s21c1
Sequence:CCGGTTGGAGAGGCCTTATGGTAATCTCGAGATTACCATAAGGCCTCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029760.2-1012s21c1
Sequence:CCGGTGGAAATTGTCCTGGTATTTGCTCGAGCAAATACCAGGACAATTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029760
NUBPL MISSION shRNA shRNA Plasmid DNA
nucleotide binding protein-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-936s21c1
Sequence:CCGGGCCAAAGCTTACCTGCATATTCTCGAGAATATGCAGGTAAGCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-450s21c1
Sequence:CCGGGGTATTGCTTGTATGTCAATGCTCGAGCATTGACATACAAGCAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-875s21c1
Sequence:CCGGTATAAGGGAAGCTTCGGATATCTCGAGATATCCGAAGCTTCCCTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-503s21c1
Sequence:CCGGTTGGAGAGGCCTTATGGTAATCTCGAGATTACCATAAGGCCTCTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029760.2-1012s21c1
Sequence:CCGGTGGAAATTGTCCTGGTATTTGCTCGAGCAAATACCAGGACAATTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029760
NUBPL MISSION shRNA Lentiviral Transduction Particles
nucleotide binding protein-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-936s21c1
Sequence:CCGGGCCAAAGCTTACCTGCATATTCTCGAGAATATGCAGGTAAGCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-450s21c1
Sequence:CCGGGGTATTGCTTGTATGTCAATGCTCGAGCATTGACATACAAGCAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-875s21c1
Sequence:CCGGTATAAGGGAAGCTTCGGATATCTCGAGATATCCGAAGCTTCCCTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029760.2-503s21c1
Sequence:CCGGTTGGAGAGGCCTTATGGTAATCTCGAGATTACCATAAGGCCTCTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029760.2-1012s21c1
Sequence:CCGGTGGAAATTGTCCTGGTATTTGCTCGAGCAAATACCAGGACAATTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)