EMAIL THIS PAGE TO A FRIEND

NUDCD1

NudC domain containing 1

91 Gene Product Result for
Synonyms: CML66 OVA66
Gene ID:
Mouse(67429) NudC domain containing 1
Rat(362906) NudC domain containing 1
sheep(101118365) NudC domain containing 1
domestic guinea pig(100725000) NudC domain containing 1
naked mole-rat(101723827) NudC domain containing 1
Domestic Rabbit(100347475) NudC domain containing 1
Zebrafish(553654) NudC domain containing 1
domestic cat(101088647) NudC domain containing 1
cow(528425) NudC domain containing 1
Horse(100056658) NudC domain containing 1
dog(475073) NudC domain containing 1
chicken(428379) NudC domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032869 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130551 MISSION® esiRNA esiRNA human NUDCD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128211 Rosetta Predictions human pricing
NM_032869 Rosetta Predictions human pricing
NM_001130561 Rosetta Predictions rat pricing
NM_001113554 Rosetta Predictions mouse pricing
NM_026149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330856 predicted 748
2 SASI_Hs02_00330857 predicted 852
3 SASI_Hs02_00330858 predicted 219
4 SASI_Hs02_00330859 predicted 1653
5 SASI_Hs02_00330860 predicted 1294
6 SASI_Hs02_00330861 predicted 733
7 SASI_Hs02_00330862 predicted 465
8 SASI_Hs02_00330863 predicted 588
9 SASI_Hs02_00330864 predicted 693
10 SASI_Hs02_00330865 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360485 predicted 923
2 SASI_Hs01_00195273 predicted 279
3 SASI_Hs01_00195275 predicted 1719
4 SASI_Hs01_00195276 predicted 812
5 SASI_Hs01_00195277 predicted 1363
6 SASI_Hs01_00195278 predicted 523
7 SASI_Hs01_00195279 predicted 797
8 SASI_Hs02_00360486 predicted 651
9 SASI_Hs01_00195280 predicted 758
10 SASI_Hs01_00195282 predicted 270
11 SASI_Hs01_00195274 predicted 1430
12 SASI_Hs01_00195281 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255779 predicted 1499
2 SASI_Rn02_00255780 predicted 1343
3 SASI_Rn02_00255781 predicted 937
4 SASI_Rn02_00255782 predicted 1004
5 SASI_Rn02_00255783 predicted 896
6 SASI_Rn02_00255784 predicted 733
7 SASI_Rn02_00255785 predicted 752
8 SASI_Rn02_00255786 predicted 593
9 SASI_Rn02_00255787 predicted 376
10 SASI_Rn02_00255788 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308163 predicted 2264
2 SASI_Mm02_00308164 predicted 1804
3 SASI_Mm02_00308165 predicted 2326
4 SASI_Mm02_00308166 predicted 732
5 SASI_Mm02_00308167 predicted 844
6 SASI_Mm02_00308168 predicted 585
7 SASI_Mm02_00308169 predicted 1086
8 SASI_Mm02_00308170 predicted 2203
9 SASI_Mm02_00308171 predicted 1613
10 SASI_Mm02_00308172 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329762 predicted 2263
2 SASI_Mm01_00128278 predicted 1815
3 SASI_Mm02_00329763 predicted 2327
4 SASI_Mm01_00128285 predicted 727
5 SASI_Mm01_00128281 predicted 846
6 SASI_Mm02_00329764 predicted 587
7 SASI_Mm01_00128286 predicted 1087
8 SASI_Mm01_00128287 predicted 2209
9 SASI_Mm02_00329765 predicted 1612
10 SASI_Mm02_00329766 predicted 1062
11 SASI_Mm01_00128279 predicted 833
12 SASI_Mm01_00128280 predicted 1004
13 SASI_Mm01_00128282 predicted 803
14 SASI_Mm01_00128283 predicted 795
15 SASI_Mm01_00128284 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026149
VALIDATED
NUDCD1 MISSION shRNA Bacterial Glycerol Stock
NudC domain containing 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026149.4-1729s21c1
Sequence:CCGGGCATGTAATGCTCAAGAATTACTCGAGTAATTCTTGAGCATTACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026149.4-747s21c1
Sequence:CCGGCAGTGTCTACTACATTGATAACTCGAGTTATCAATGTAGTAGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-1405s1c1
Sequence:CCGGCTTCCAGAAAGCAGTACTAAGCTCGAGCTTAGTACTGCTTTCTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026149.2-2635s1c1
Sequence:CCGGGCTTCCTGACATCATACAGAACTCGAGTTCTGTATGATGTCAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-1525s1c1
Sequence:CCGGGGCAGCACATGGACAATTAAACTCGAGTTTAATTGTCCATGTGCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026149.2-329s1c1
Sequence:CCGGCAGTGTCTACTACATTGATAACTCGAGTTATCAATGTAGTAGACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.2-1311s1c1
Sequence:CCGGGCATGTAATGCTCAAGAATTACTCGAGTAATTCTTGAGCATTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.2-798s1c1
Sequence:CCGGGTGCCACATTATGCTGCAATTCTCGAGAATTGCAGCATAATGTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026149.2-2503s1c1
Sequence:CCGGGCTGGAGAGTTAGCAGTTCAACTCGAGTTGAACTGCTAACTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026149.2-2744s1c1
Sequence:CCGGGCTACGTCTAAACAGACAGTACTCGAGTACTGTCTGTTTAGACGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-2261s1c1
Sequence:CCGGGAGTAAATACGGAGAATTAATCTCGAGATTAATTCTCCGTATTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-1240s1c1
Sequence:CCGGCCTAATGGAAATGGTCTAATGCTCGAGCATTAGACCATTTCCATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026149.4-2909s21c1
Sequence:CCGGGCTGGAGAGTTAGCAGTTCAACTCGAGTTGAACTGCTAACTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026149.4-1216s21c1
Sequence:CCGGGTGCCACATTATGCTGCAATTCTCGAGAATTGCAGCATAATGTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026149
VALIDATED
NUDCD1 MISSION shRNA shRNA Plasmid DNA
NudC domain containing 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026149.4-1729s21c1
Sequence:CCGGGCATGTAATGCTCAAGAATTACTCGAGTAATTCTTGAGCATTACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026149.4-747s21c1
Sequence:CCGGCAGTGTCTACTACATTGATAACTCGAGTTATCAATGTAGTAGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-1405s1c1
Sequence:CCGGCTTCCAGAAAGCAGTACTAAGCTCGAGCTTAGTACTGCTTTCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026149.2-2635s1c1
Sequence:CCGGGCTTCCTGACATCATACAGAACTCGAGTTCTGTATGATGTCAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-1525s1c1
Sequence:CCGGGGCAGCACATGGACAATTAAACTCGAGTTTAATTGTCCATGTGCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026149.2-329s1c1
Sequence:CCGGCAGTGTCTACTACATTGATAACTCGAGTTATCAATGTAGTAGACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.2-1311s1c1
Sequence:CCGGGCATGTAATGCTCAAGAATTACTCGAGTAATTCTTGAGCATTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.2-798s1c1
Sequence:CCGGGTGCCACATTATGCTGCAATTCTCGAGAATTGCAGCATAATGTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026149.2-2503s1c1
Sequence:CCGGGCTGGAGAGTTAGCAGTTCAACTCGAGTTGAACTGCTAACTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026149.2-2744s1c1
Sequence:CCGGGCTACGTCTAAACAGACAGTACTCGAGTACTGTCTGTTTAGACGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-2261s1c1
Sequence:CCGGGAGTAAATACGGAGAATTAATCTCGAGATTAATTCTCCGTATTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-1240s1c1
Sequence:CCGGCCTAATGGAAATGGTCTAATGCTCGAGCATTAGACCATTTCCATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026149.4-2909s21c1
Sequence:CCGGGCTGGAGAGTTAGCAGTTCAACTCGAGTTGAACTGCTAACTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026149.4-1216s21c1
Sequence:CCGGGTGCCACATTATGCTGCAATTCTCGAGAATTGCAGCATAATGTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026149
VALIDATED
NUDCD1 MISSION shRNA Lentiviral Transduction Particles
NudC domain containing 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026149.4-1729s21c1
Sequence:CCGGGCATGTAATGCTCAAGAATTACTCGAGTAATTCTTGAGCATTACATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026149.4-747s21c1
Sequence:CCGGCAGTGTCTACTACATTGATAACTCGAGTTATCAATGTAGTAGACACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-1405s1c1
Sequence:CCGGCTTCCAGAAAGCAGTACTAAGCTCGAGCTTAGTACTGCTTTCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026149.2-2635s1c1
Sequence:CCGGGCTTCCTGACATCATACAGAACTCGAGTTCTGTATGATGTCAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-1525s1c1
Sequence:CCGGGGCAGCACATGGACAATTAAACTCGAGTTTAATTGTCCATGTGCTGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026149.2-329s1c1
Sequence:CCGGCAGTGTCTACTACATTGATAACTCGAGTTATCAATGTAGTAGACACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.2-1311s1c1
Sequence:CCGGGCATGTAATGCTCAAGAATTACTCGAGTAATTCTTGAGCATTACATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.2-798s1c1
Sequence:CCGGGTGCCACATTATGCTGCAATTCTCGAGAATTGCAGCATAATGTGGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026149.2-2503s1c1
Sequence:CCGGGCTGGAGAGTTAGCAGTTCAACTCGAGTTGAACTGCTAACTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026149.2-2744s1c1
Sequence:CCGGGCTACGTCTAAACAGACAGTACTCGAGTACTGTCTGTTTAGACGTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-2261s1c1
Sequence:CCGGGAGTAAATACGGAGAATTAATCTCGAGATTAATTCTCCGTATTTACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026149.4-1240s1c1
Sequence:CCGGCCTAATGGAAATGGTCTAATGCTCGAGCATTAGACCATTTCCATTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026149.4-2909s21c1
Sequence:CCGGGCTGGAGAGTTAGCAGTTCAACTCGAGTTGAACTGCTAACTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026149.4-1216s21c1
Sequence:CCGGGTGCCACATTATGCTGCAATTCTCGAGAATTGCAGCATAATGTGGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032869
VALIDATED
NUDCD1 MISSION shRNA Bacterial Glycerol Stock
NudC domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_032869.3-1516s21c1
Sequence:CCGGCACTCCAGCAAACAAGATGATCTCGAGATCATCTTGTTTGCTGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032869.3-1691s21c1
Sequence:CCGGCCACTGTACTTTACAACAGAACTCGAGTTCTGTTGTAAAGTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032869.2-1104s1c1
Sequence:CCGGGCTTGGAGATTTCCTTGATTACTCGAGTAATCAAGGAAATCTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032869.2-1481s1c1
Sequence:CCGGCACTCCAGCAAACAAGATGATCTCGAGATCATCTTGTTTGCTGGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032869.2-3217s1c1
Sequence:CCGGGCTAGGTAGAAAGTTAGGAAACTCGAGTTTCCTAACTTTCTACCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032869.2-1656s1c1
Sequence:CCGGCCACTGTACTTTACAACAGAACTCGAGTTCTGTTGTAAAGTACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032869.3-2193s21c1
Sequence:CCGGGTGTACTCTGTTCGTTGATTACTCGAGTAATCAACGAACAGAGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032869.3-1139s21c1
Sequence:CCGGGCTTGGAGATTTCCTTGATTACTCGAGTAATCAAGGAAATCTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032869
VALIDATED
NUDCD1 MISSION shRNA shRNA Plasmid DNA
NudC domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_032869.3-1516s21c1
Sequence:CCGGCACTCCAGCAAACAAGATGATCTCGAGATCATCTTGTTTGCTGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032869.3-1691s21c1
Sequence:CCGGCCACTGTACTTTACAACAGAACTCGAGTTCTGTTGTAAAGTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032869.2-1104s1c1
Sequence:CCGGGCTTGGAGATTTCCTTGATTACTCGAGTAATCAAGGAAATCTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032869.2-1481s1c1
Sequence:CCGGCACTCCAGCAAACAAGATGATCTCGAGATCATCTTGTTTGCTGGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032869.2-3217s1c1
Sequence:CCGGGCTAGGTAGAAAGTTAGGAAACTCGAGTTTCCTAACTTTCTACCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032869.2-1656s1c1
Sequence:CCGGCCACTGTACTTTACAACAGAACTCGAGTTCTGTTGTAAAGTACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032869.3-2193s21c1
Sequence:CCGGGTGTACTCTGTTCGTTGATTACTCGAGTAATCAACGAACAGAGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032869.3-1139s21c1
Sequence:CCGGGCTTGGAGATTTCCTTGATTACTCGAGTAATCAAGGAAATCTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032869
VALIDATED
NUDCD1 MISSION shRNA Lentiviral Transduction Particles
NudC domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_032869.3-1516s21c1
Sequence:CCGGCACTCCAGCAAACAAGATGATCTCGAGATCATCTTGTTTGCTGGAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032869.3-1691s21c1
Sequence:CCGGCCACTGTACTTTACAACAGAACTCGAGTTCTGTTGTAAAGTACAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032869.2-1104s1c1
Sequence:CCGGGCTTGGAGATTTCCTTGATTACTCGAGTAATCAAGGAAATCTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032869.2-1481s1c1
Sequence:CCGGCACTCCAGCAAACAAGATGATCTCGAGATCATCTTGTTTGCTGGAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150191    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032869.2-3217s1c1
Sequence:CCGGGCTAGGTAGAAAGTTAGGAAACTCGAGTTTCCTAACTTTCTACCTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032869.2-1656s1c1
Sequence:CCGGCCACTGTACTTTACAACAGAACTCGAGTTCTGTTGTAAAGTACAGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032869.3-2193s21c1
Sequence:CCGGGTGTACTCTGTTCGTTGATTACTCGAGTAATCAACGAACAGAGTACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032869.3-1139s21c1
Sequence:CCGGGCTTGGAGATTTCCTTGATTACTCGAGTAATCAAGGAAATCTCCAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)