EMAIL THIS PAGE TO A FRIEND

NUDCD2

NudC domain containing 2

75 Gene Product Result for
UniProtKB ID: Q8WVJ2, B2R4V0
Gene ID:
Mouse(52653) NudC domain containing 2
Rat(287199) NudC domain containing 2
Zebrafish(445145) NudC domain containing 2
cow(532693) NudC domain containing 2
domestic cat(101087451) NudC domain containing 2
dog(479302) NudC domain containing 2
chicken(416162) NudC domain containing 2
naked mole-rat(101716765) NudC domain containing 2
domestic guinea pig(100730099) NudC domain containing 2
sheep(101119472) NudC domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145266 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077841 MISSION® esiRNA esiRNA targeting mouse Nudcd2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145266 Rosetta Predictions human pricing
NM_001009621 Rosetta Predictions rat pricing
NM_026023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102165 predicted 370
2 SASI_Hs01_00102166 predicted 381
3 SASI_Hs01_00102168 predicted 579
4 SASI_Hs01_00102170 predicted 589
5 SASI_Hs01_00102171 predicted 532
6 SASI_Hs01_00102172 predicted 336
7 SASI_Hs01_00102173 predicted 601
8 SASI_Hs02_00365135 predicted 365
9 SASI_Hs02_00365136 predicted 517
10 SASI_Hs02_00365137 predicted 545
11 SASI_Hs01_00102167 predicted 521
12 SASI_Hs01_00102169 predicted 361
13 SASI_Hs01_00102174 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077555 predicted 898
2 SASI_Rn01_00077556 predicted 689
3 SASI_Rn01_00077557 predicted 659
4 SASI_Rn01_00077558 predicted 864
5 SASI_Rn01_00077559 predicted 726
6 SASI_Rn01_00077560 predicted 1036
7 SASI_Rn01_00077561 predicted 507
8 SASI_Rn01_00077562 predicted 880
9 SASI_Rn01_00077563 predicted 941
10 SASI_Rn01_00077564 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127537 predicted 598
2 SASI_Mm01_00127538 predicted 605
3 SASI_Mm02_00329494 predicted 898
4 SASI_Mm02_00329495 predicted 878
5 SASI_Mm01_00127542 predicted 788
6 SASI_Mm01_00127543 predicted 792
7 SASI_Mm02_00329496 predicted 608
8 SASI_Mm01_00127545 predicted 791
9 SASI_Mm02_00329497 predicted 867
10 SASI_Mm01_00127546 predicted 841
11 SASI_Mm01_00127539 predicted 876
12 SASI_Mm01_00127540 predicted 715
13 SASI_Mm01_00127541 predicted 866
14 SASI_Mm01_00127544 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145266
VALIDATED
NUDCD2 MISSION shRNA Bacterial Glycerol Stock
NudC domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-523s21c1
Sequence:CCGGACTAAAGGTGGACCAGATTTCCTCGAGGAAATCTGGTCCACCTTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-400s1c1
Sequence:CCGGGAATCTGAATATGCAGCGGATCTCGAGATCCGCTGCATATTCAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-497s1c1
Sequence:CCGGGTGGAGCAGAAATCTCAGGAACTCGAGTTCCTGAGATTTCTGCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-278s1c1
Sequence:CCGGGCAAACTCTTTGATTCTACAACTCGAGTTGTAGAATCAAAGAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-304s21c1
Sequence:CCGGGATGAGGGAACATGGACTTTGCTCGAGCAAAGTCCATGTTCCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-340s21c1
Sequence:CCGGGTTCGTATTGTTCTTACAAAGCTCGAGCTTTGTAAGAACAATACGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145266.4-582s21c1
Sequence:CCGGTGTGGATCCTAGCAGATATTGCTCGAGCAATATCTGCTAGGATCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-376s21c1
Sequence:CCGGGCAAATTGTTGGACTTCTCTACTCGAGTAGAGAAGTCCAACAATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-163s1c1
Sequence:CCGGGAGGAGGTGTTCATTGAAGTTCTCGAGAACTTCAATGAACACCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145266
VALIDATED
NUDCD2 MISSION shRNA shRNA Plasmid DNA
NudC domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-523s21c1
Sequence:CCGGACTAAAGGTGGACCAGATTTCCTCGAGGAAATCTGGTCCACCTTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-400s1c1
Sequence:CCGGGAATCTGAATATGCAGCGGATCTCGAGATCCGCTGCATATTCAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-497s1c1
Sequence:CCGGGTGGAGCAGAAATCTCAGGAACTCGAGTTCCTGAGATTTCTGCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-278s1c1
Sequence:CCGGGCAAACTCTTTGATTCTACAACTCGAGTTGTAGAATCAAAGAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-304s21c1
Sequence:CCGGGATGAGGGAACATGGACTTTGCTCGAGCAAAGTCCATGTTCCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-340s21c1
Sequence:CCGGGTTCGTATTGTTCTTACAAAGCTCGAGCTTTGTAAGAACAATACGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145266.4-582s21c1
Sequence:CCGGTGTGGATCCTAGCAGATATTGCTCGAGCAATATCTGCTAGGATCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-376s21c1
Sequence:CCGGGCAAATTGTTGGACTTCTCTACTCGAGTAGAGAAGTCCAACAATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-163s1c1
Sequence:CCGGGAGGAGGTGTTCATTGAAGTTCTCGAGAACTTCAATGAACACCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145266
VALIDATED
NUDCD2 MISSION shRNA Lentiviral Transduction Particles
NudC domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-523s21c1
Sequence:CCGGACTAAAGGTGGACCAGATTTCCTCGAGGAAATCTGGTCCACCTTTAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-400s1c1
Sequence:CCGGGAATCTGAATATGCAGCGGATCTCGAGATCCGCTGCATATTCAGATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-497s1c1
Sequence:CCGGGTGGAGCAGAAATCTCAGGAACTCGAGTTCCTGAGATTTCTGCTCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-278s1c1
Sequence:CCGGGCAAACTCTTTGATTCTACAACTCGAGTTGTAGAATCAAAGAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-304s21c1
Sequence:CCGGGATGAGGGAACATGGACTTTGCTCGAGCAAAGTCCATGTTCCCTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-340s21c1
Sequence:CCGGGTTCGTATTGTTCTTACAAAGCTCGAGCTTTGTAAGAACAATACGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145266.4-582s21c1
Sequence:CCGGTGTGGATCCTAGCAGATATTGCTCGAGCAATATCTGCTAGGATCCACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145266.4-376s21c1
Sequence:CCGGGCAAATTGTTGGACTTCTCTACTCGAGTAGAGAAGTCCAACAATTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145266.4-163s1c1
Sequence:CCGGGAGGAGGTGTTCATTGAAGTTCTCGAGAACTTCAATGAACACCTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026023
VALIDATED
NUDCD2 MISSION shRNA Bacterial Glycerol Stock
NudC domain containing 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026023.3-641s1c1
Sequence:CCGGGCAAGACCAAATGCAGAGAAACTCGAGTTTCTCTGCATTTGGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026023.3-588s1c1
Sequence:CCGGGCAAACTGTTGGACTTCTCTTCTCGAGAAGAGAAGTCCAACAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026023.3-1291s1c1
Sequence:CCGGCCTAAGTGATTATGTCAAGAACTCGAGTTCTTGACATAATCACTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026023.3-508s1c1
Sequence:CCGGCAATTGCTGATGAAGGAACATCTCGAGATGTTCCTTCATCAGCAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026023
VALIDATED
NUDCD2 MISSION shRNA shRNA Plasmid DNA
NudC domain containing 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026023.3-641s1c1
Sequence:CCGGGCAAGACCAAATGCAGAGAAACTCGAGTTTCTCTGCATTTGGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026023.3-588s1c1
Sequence:CCGGGCAAACTGTTGGACTTCTCTTCTCGAGAAGAGAAGTCCAACAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026023.3-1291s1c1
Sequence:CCGGCCTAAGTGATTATGTCAAGAACTCGAGTTCTTGACATAATCACTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026023.3-508s1c1
Sequence:CCGGCAATTGCTGATGAAGGAACATCTCGAGATGTTCCTTCATCAGCAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026023
VALIDATED
NUDCD2 MISSION shRNA Lentiviral Transduction Particles
NudC domain containing 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026023.3-641s1c1
Sequence:CCGGGCAAGACCAAATGCAGAGAAACTCGAGTTTCTCTGCATTTGGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026023.3-588s1c1
Sequence:CCGGGCAAACTGTTGGACTTCTCTTCTCGAGAAGAGAAGTCCAACAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026023.3-1291s1c1
Sequence:CCGGCCTAAGTGATTATGTCAAGAACTCGAGTTCTTGACATAATCACTTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026023.3-508s1c1
Sequence:CCGGCAATTGCTGATGAAGGAACATCTCGAGATGTTCCTTCATCAGCAATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)