EMAIL THIS PAGE TO A FRIEND

NUDT12

nudix (nucleoside diphosphate linked moiety X)-type motif 12

71 Gene Product Result for
UniProtKB ID: Q9BQG2, B3KUW2, Q8TAL7
Gene ID:
Human(83594) Summary: Nucleotides are involved in numerous biochemical reactions and pathways within the cell as substrates, cofactors, and effectors. Nudix hydrolases, such as NUDT12, regulate the concentrations of individual nucleotides and of nucleotide ratios in response to changing circumstances (Abdelraheim et al., 2003 [PubMed 12790796]
Mouse(67993) nudix (nucleoside diphosphate linked moiety X)-type motif 12
Rat(367323) nudix (nucleoside diphosphate linked moiety X)-type motif 12
sheep(101115365) nudix (nucleoside diphosphate linked moiety X)-type motif 12
domestic guinea pig(100735803) nudix (nucleoside diphosphate linked moiety X)-type motif 12
Thale Cress(837845) nudix hydrolase 12
chicken(768471) nudix (nucleoside diphosphate linked moiety X)-type motif 12
dog(488881) nudix (nucleoside diphosphate linked moiety X)-type motif 12
cow(617720) nudix (nucleoside diphosphate linked moiety X)-type motif 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031438 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031438 Rosetta Predictions human pricing
NM_001109010 Rosetta Predictions rat pricing
NM_026497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358847 predicted 1475
2 SASI_Hs01_00091971 predicted 1062
3 SASI_Hs01_00091972 predicted 563
4 SASI_Hs01_00091973 predicted 1427
5 SASI_Hs01_00091974 predicted 298
6 SASI_Hs01_00091977 predicted 1011
7 SASI_Hs02_00358848 predicted 1368
8 SASI_Hs01_00091979 predicted 1271
9 SASI_Hs01_00091980 predicted 1482
10 SASI_Hs02_00358849 predicted 280
11 SASI_Hs01_00091975 predicted 635
12 SASI_Hs01_00091976 predicted 620
13 SASI_Hs01_00091978 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244284 predicted 202
2 SASI_Rn02_00244285 predicted 1534
3 SASI_Rn02_00244286 predicted 1057
4 SASI_Rn02_00244287 predicted 1041
5 SASI_Rn02_00244288 predicted 1441
6 SASI_Rn02_00244289 predicted 1243
7 SASI_Rn02_00244290 predicted 394
8 SASI_Rn02_00244291 predicted 673
9 SASI_Rn02_00244292 predicted 1443
10 SASI_Rn02_00244293 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048803 predicted 1541
2 SASI_Mm01_00048804 predicted 1042
3 SASI_Mm01_00048805 predicted 1062
4 SASI_Mm01_00048806 predicted 320
5 SASI_Mm01_00048807 predicted 1152
6 SASI_Mm01_00048808 predicted 674
7 SASI_Mm02_00330386 predicted 1247
8 SASI_Mm02_00330387 predicted 224
9 SASI_Mm01_00048809 predicted 1255
10 SASI_Mm01_00048810 predicted 1553
11 SASI_Mm01_00048811 predicted 294
12 SASI_Mm01_00048812 predicted 1329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031438
VALIDATED
NUDT12 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031438.2-1489s21c1
Sequence:CCGGGAACTAAGCTTTGAGTATTATCTCGAGATAATACTCAAAGCTTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031438.2-1143s21c1
Sequence:CCGGTACTTGCCTTGCTGGATTTATCTCGAGATAAATCCAGCAAGGCAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031438.2-1018s21c1
Sequence:CCGGAGTCTCAATGGCGTCCATAATCTCGAGATTATGGACGCCATTGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031438.2-571s21c1
Sequence:CCGGGTTACTCTAGGTGGCAATAAACTCGAGTTTATTGCCACCTAGAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-778s1c1
Sequence:CCGGGCTCTAGGTATAGATCCTATTCTCGAGAATAGGATCTATACCTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-1060s1c1
Sequence:CCGGCCAGTAGTAATCATGCAAGTTCTCGAGAACTTGCATGATTACTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-1424s1c1
Sequence:CCGGGCCGAGCTATTGCACATCAATCTCGAGATTGATGTGCAATAGCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-627s1c1
Sequence:CCGGGCTGAACTACACAGATATAAACTCGAGTTTATATCTGTGTAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031438.2-1292s1c1
Sequence:CCGGGCTTAGCTCTAGCAGTGTCTACTCGAGTAGACACTGCTAGAGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031438
VALIDATED
NUDT12 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031438.2-1489s21c1
Sequence:CCGGGAACTAAGCTTTGAGTATTATCTCGAGATAATACTCAAAGCTTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031438.2-1143s21c1
Sequence:CCGGTACTTGCCTTGCTGGATTTATCTCGAGATAAATCCAGCAAGGCAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031438.2-1018s21c1
Sequence:CCGGAGTCTCAATGGCGTCCATAATCTCGAGATTATGGACGCCATTGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031438.2-571s21c1
Sequence:CCGGGTTACTCTAGGTGGCAATAAACTCGAGTTTATTGCCACCTAGAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-778s1c1
Sequence:CCGGGCTCTAGGTATAGATCCTATTCTCGAGAATAGGATCTATACCTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-1060s1c1
Sequence:CCGGCCAGTAGTAATCATGCAAGTTCTCGAGAACTTGCATGATTACTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-1424s1c1
Sequence:CCGGGCCGAGCTATTGCACATCAATCTCGAGATTGATGTGCAATAGCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-627s1c1
Sequence:CCGGGCTGAACTACACAGATATAAACTCGAGTTTATATCTGTGTAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031438.2-1292s1c1
Sequence:CCGGGCTTAGCTCTAGCAGTGTCTACTCGAGTAGACACTGCTAGAGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031438
VALIDATED
NUDT12 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031438.2-1489s21c1
Sequence:CCGGGAACTAAGCTTTGAGTATTATCTCGAGATAATACTCAAAGCTTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031438.2-1143s21c1
Sequence:CCGGTACTTGCCTTGCTGGATTTATCTCGAGATAAATCCAGCAAGGCAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031438.2-1018s21c1
Sequence:CCGGAGTCTCAATGGCGTCCATAATCTCGAGATTATGGACGCCATTGAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031438.2-571s21c1
Sequence:CCGGGTTACTCTAGGTGGCAATAAACTCGAGTTTATTGCCACCTAGAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-778s1c1
Sequence:CCGGGCTCTAGGTATAGATCCTATTCTCGAGAATAGGATCTATACCTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-1060s1c1
Sequence:CCGGCCAGTAGTAATCATGCAAGTTCTCGAGAACTTGCATGATTACTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-1424s1c1
Sequence:CCGGGCCGAGCTATTGCACATCAATCTCGAGATTGATGTGCAATAGCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031438.2-627s1c1
Sequence:CCGGGCTGAACTACACAGATATAAACTCGAGTTTATATCTGTGTAGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031438.2-1292s1c1
Sequence:CCGGGCTTAGCTCTAGCAGTGTCTACTCGAGTAGACACTGCTAGAGCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026497
NUDT12 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026497.1-1824s1c1
Sequence:CCGGCCTTAGTTCATCTCATGGAAACTCGAGTTTCCATGAGATGAACTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-655s1c1
Sequence:CCGGCCCGGATGTAAAGGGTTACTTCTCGAGAAGTAACCCTTTACATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-548s1c1
Sequence:CCGGCCCACCACAGTTTATCTCCTTCTCGAGAAGGAGATAAACTGTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-1068s1c1
Sequence:CCGGCGAGAGTTGATCCAGTCGTAACTCGAGTTACGACTGGATCAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-356s1c1
Sequence:CCGGGCCCTGGATATTGCTGCATTTCTCGAGAAATGCAGCAATATCCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026497
NUDT12 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026497.1-1824s1c1
Sequence:CCGGCCTTAGTTCATCTCATGGAAACTCGAGTTTCCATGAGATGAACTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-655s1c1
Sequence:CCGGCCCGGATGTAAAGGGTTACTTCTCGAGAAGTAACCCTTTACATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-548s1c1
Sequence:CCGGCCCACCACAGTTTATCTCCTTCTCGAGAAGGAGATAAACTGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-1068s1c1
Sequence:CCGGCGAGAGTTGATCCAGTCGTAACTCGAGTTACGACTGGATCAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-356s1c1
Sequence:CCGGGCCCTGGATATTGCTGCATTTCTCGAGAAATGCAGCAATATCCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026497
NUDT12 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026497.1-1824s1c1
Sequence:CCGGCCTTAGTTCATCTCATGGAAACTCGAGTTTCCATGAGATGAACTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-655s1c1
Sequence:CCGGCCCGGATGTAAAGGGTTACTTCTCGAGAAGTAACCCTTTACATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-548s1c1
Sequence:CCGGCCCACCACAGTTTATCTCCTTCTCGAGAAGGAGATAAACTGTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-1068s1c1
Sequence:CCGGCGAGAGTTGATCCAGTCGTAACTCGAGTTACGACTGGATCAACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026497.1-356s1c1
Sequence:CCGGGCCCTGGATATTGCTGCATTTCTCGAGAAATGCAGCAATATCCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)