EMAIL THIS PAGE TO A FRIEND

NUDT13

nudix (nucleoside diphosphate linked moiety X)-type motif 13

71 Gene Product Result for
UniProtKB ID: Q86X67, O95650, Q5SQM4, Q5SQM5, Q9Y3X2
Gene ID:
Mouse(67725) nudix (nucleoside diphosphate linked moiety X)-type motif 13
Rat(682978) nudix (nucleoside diphosphate linked moiety X)-type motif 13
Zebrafish(556815) nudix (nucleoside diphosphate linked moiety X)-type motif 13
domestic cat(101084905) nudix (nucleoside diphosphate linked moiety X)-type motif 13
cow(504993) nudix (nucleoside diphosphate linked moiety X)-type motif 13
Horse(100063793) nudix (nucleoside diphosphate linked moiety X)-type motif 13
dog(479243) nudix (nucleoside diphosphate linked moiety X)-type motif 13
chicken(423703) nudix (nucleoside diphosphate linked moiety X)-type motif 13
domestic guinea pig(100717016) nudix (nucleoside diphosphate linked moiety X)-type motif 13
naked mole-rat(101703950) nudix (nucleoside diphosphate linked moiety X)-type motif 13
sheep(101116956) nudix (nucleoside diphosphate linked moiety X)-type motif 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015901 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015901 Rosetta Predictions human pricing
NM_001127636 Rosetta Predictions rat pricing
NM_026341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051948 predicted 364
2 SASI_Hs01_00051949 predicted 1193
3 SASI_Hs01_00051951 predicted 482
4 SASI_Hs01_00051953 predicted 206
5 SASI_Hs01_00051954 predicted 225
6 SASI_Hs01_00051955 predicted 870
7 SASI_Hs02_00348490 predicted 687
8 SASI_Hs01_00051956 predicted 969
9 SASI_Hs01_00051957 predicted 1135
10 SASI_Hs02_00348491 predicted 433
11 SASI_Hs01_00051950 predicted 687
12 SASI_Hs01_00051952 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254690 predicted 1536
2 SASI_Rn02_00254691 predicted 1263
3 SASI_Rn02_00254692 predicted 1600
4 SASI_Rn02_00254693 predicted 1587
5 SASI_Rn02_00254694 predicted 1381
6 SASI_Rn02_00254695 predicted 639
7 SASI_Rn02_00254696 predicted 769
8 SASI_Rn02_00254697 predicted 1374
9 SASI_Rn02_00254698 predicted 1586
10 SASI_Rn02_00254699 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330054 predicted 822
2 SASI_Mm02_00330055 predicted 804
3 SASI_Mm01_00116234 predicted 965
4 SASI_Mm01_00116235 predicted 1215
5 SASI_Mm02_00330056 predicted 1148
6 SASI_Mm01_00116236 predicted 425
7 SASI_Mm01_00116239 predicted 232
8 SASI_Mm01_00116240 predicted 946
9 SASI_Mm02_00330057 predicted 506
10 SASI_Mm01_00116241 predicted 921
11 SASI_Mm01_00116233 predicted 759
12 SASI_Mm01_00116237 predicted 1261
13 SASI_Mm01_00116238 predicted 1259
14 SASI_Mm01_00116242 predicted 1063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026341
VALIDATED
NUDT13 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 13
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-1108s21c1
Sequence:CCGGCCATTGCCCACCACTTGATTACTCGAGTAATCAAGTGGTGGGCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-666s21c1
Sequence:CCGGCGAGTGTGTCCCTCCAGTAAACTCGAGTTTACTGGAGGGACACACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-840s21c1
Sequence:CCGGCATCGAGAAGTTGCGGAAGAGCTCGAGCTCTTCCGCAACTTCTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026341.1-1255s1c1
Sequence:CCGGGCCTTCTAATGCTCCACCAAACTCGAGTTTGGTGGAGCATTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026341.1-148s1c1
Sequence:CCGGCTATGTCACTAAGGCACGATACTCGAGTATCGTGCCTTAGTGACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026341.1-331s1c1
Sequence:CCGGCGGACAGGATTCGCAAAGAATCTCGAGATTCTTTGCGAATCCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026341.1-758s1c1
Sequence:CCGGCCTGCGAGTTTCTGTGACATACTCGAGTATGTCACAGAAACTCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-473s21c1
Sequence:CCGGCTCCTTGCCGAAATCTGAAATCTCGAGATTTCAGATTTCGGCAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026341.1-472s1c1
Sequence:CCGGGCTGGGAGGTTCTTTCATCAACTCGAGTTGATGAAAGAACCTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026341
VALIDATED
NUDT13 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 13
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-1108s21c1
Sequence:CCGGCCATTGCCCACCACTTGATTACTCGAGTAATCAAGTGGTGGGCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-666s21c1
Sequence:CCGGCGAGTGTGTCCCTCCAGTAAACTCGAGTTTACTGGAGGGACACACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-840s21c1
Sequence:CCGGCATCGAGAAGTTGCGGAAGAGCTCGAGCTCTTCCGCAACTTCTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026341.1-1255s1c1
Sequence:CCGGGCCTTCTAATGCTCCACCAAACTCGAGTTTGGTGGAGCATTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026341.1-148s1c1
Sequence:CCGGCTATGTCACTAAGGCACGATACTCGAGTATCGTGCCTTAGTGACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026341.1-331s1c1
Sequence:CCGGCGGACAGGATTCGCAAAGAATCTCGAGATTCTTTGCGAATCCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026341.1-758s1c1
Sequence:CCGGCCTGCGAGTTTCTGTGACATACTCGAGTATGTCACAGAAACTCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-473s21c1
Sequence:CCGGCTCCTTGCCGAAATCTGAAATCTCGAGATTTCAGATTTCGGCAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026341.1-472s1c1
Sequence:CCGGGCTGGGAGGTTCTTTCATCAACTCGAGTTGATGAAAGAACCTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026341
VALIDATED
NUDT13 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 13
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-1108s21c1
Sequence:CCGGCCATTGCCCACCACTTGATTACTCGAGTAATCAAGTGGTGGGCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-666s21c1
Sequence:CCGGCGAGTGTGTCCCTCCAGTAAACTCGAGTTTACTGGAGGGACACACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-840s21c1
Sequence:CCGGCATCGAGAAGTTGCGGAAGAGCTCGAGCTCTTCCGCAACTTCTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026341.1-1255s1c1
Sequence:CCGGGCCTTCTAATGCTCCACCAAACTCGAGTTTGGTGGAGCATTAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026341.1-148s1c1
Sequence:CCGGCTATGTCACTAAGGCACGATACTCGAGTATCGTGCCTTAGTGACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026341.1-331s1c1
Sequence:CCGGCGGACAGGATTCGCAAAGAATCTCGAGATTCTTTGCGAATCCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026341.1-758s1c1
Sequence:CCGGCCTGCGAGTTTCTGTGACATACTCGAGTATGTCACAGAAACTCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026341.2-473s21c1
Sequence:CCGGCTCCTTGCCGAAATCTGAAATCTCGAGATTTCAGATTTCGGCAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026341.1-472s1c1
Sequence:CCGGGCTGGGAGGTTCTTTCATCAACTCGAGTTGATGAAAGAACCTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015901
VALIDATED
NUDT13 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015901.4-1628s21c1
Sequence:CCGGTGTTACCCTTACAGAATTAAGCTCGAGCTTAATTCTGTAAGGGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015901.4-302s21c1
Sequence:CCGGTCAGACTTCAGCACATCAATACTCGAGTATTGATGTGCTGAAGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015901.4-886s21c1
Sequence:CCGGTGGAAAGCCTGCAGTACTATGCTCGAGCATAGTACTGCAGGCTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015901.4-987s21c1
Sequence:CCGGCAGGTGAACTTGAGAGAATTACTCGAGTAATTCTCTCAAGTTCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015901.4-483s21c1
Sequence:CCGGGCCTCCTTACACAAACCTGAACTCGAGTTCAGGTTTGTGTAAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015901.3-293s1c1
Sequence:CCGGCTGGGTAAATTTGGACAGGATCTCGAGATCCTGTCCAAATTTACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015901.3-413s1c1
Sequence:CCGGGCCTCCTTACACAAACCTGAACTCGAGTTCAGGTTTGTGTAAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015901.3-650s1c1
Sequence:CCGGCAGGTGAACTTGAGAGAATTACTCGAGTAATTCTCTCAAGTTCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015901.3-797s1c1
Sequence:CCGGCTGATTAAGGAGTGGGTGGAACTCGAGTTCCACCCACTCCTTAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015901.3-112s1c1
Sequence:CCGGGCTGTCAACCTATGTTACTAACTCGAGTTAGTAACATAGGTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015901
VALIDATED
NUDT13 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015901.4-1628s21c1
Sequence:CCGGTGTTACCCTTACAGAATTAAGCTCGAGCTTAATTCTGTAAGGGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015901.4-302s21c1
Sequence:CCGGTCAGACTTCAGCACATCAATACTCGAGTATTGATGTGCTGAAGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015901.4-886s21c1
Sequence:CCGGTGGAAAGCCTGCAGTACTATGCTCGAGCATAGTACTGCAGGCTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015901.4-987s21c1
Sequence:CCGGCAGGTGAACTTGAGAGAATTACTCGAGTAATTCTCTCAAGTTCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015901.4-483s21c1
Sequence:CCGGGCCTCCTTACACAAACCTGAACTCGAGTTCAGGTTTGTGTAAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015901.3-293s1c1
Sequence:CCGGCTGGGTAAATTTGGACAGGATCTCGAGATCCTGTCCAAATTTACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015901.3-413s1c1
Sequence:CCGGGCCTCCTTACACAAACCTGAACTCGAGTTCAGGTTTGTGTAAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015901.3-650s1c1
Sequence:CCGGCAGGTGAACTTGAGAGAATTACTCGAGTAATTCTCTCAAGTTCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015901.3-797s1c1
Sequence:CCGGCTGATTAAGGAGTGGGTGGAACTCGAGTTCCACCCACTCCTTAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015901.3-112s1c1
Sequence:CCGGGCTGTCAACCTATGTTACTAACTCGAGTTAGTAACATAGGTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015901
VALIDATED
NUDT13 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015901.4-1628s21c1
Sequence:CCGGTGTTACCCTTACAGAATTAAGCTCGAGCTTAATTCTGTAAGGGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015901.4-302s21c1
Sequence:CCGGTCAGACTTCAGCACATCAATACTCGAGTATTGATGTGCTGAAGTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015901.4-886s21c1
Sequence:CCGGTGGAAAGCCTGCAGTACTATGCTCGAGCATAGTACTGCAGGCTTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015901.4-987s21c1
Sequence:CCGGCAGGTGAACTTGAGAGAATTACTCGAGTAATTCTCTCAAGTTCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015901.4-483s21c1
Sequence:CCGGGCCTCCTTACACAAACCTGAACTCGAGTTCAGGTTTGTGTAAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015901.3-293s1c1
Sequence:CCGGCTGGGTAAATTTGGACAGGATCTCGAGATCCTGTCCAAATTTACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015901.3-413s1c1
Sequence:CCGGGCCTCCTTACACAAACCTGAACTCGAGTTCAGGTTTGTGTAAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015901.3-650s1c1
Sequence:CCGGCAGGTGAACTTGAGAGAATTACTCGAGTAATTCTCTCAAGTTCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015901.3-797s1c1
Sequence:CCGGCTGATTAAGGAGTGGGTGGAACTCGAGTTCCACCCACTCCTTAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015901.3-112s1c1
Sequence:CCGGGCTGTCAACCTATGTTACTAACTCGAGTTAGTAACATAGGTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)