EMAIL THIS PAGE TO A FRIEND

NUDT16

nudix (nucleoside diphosphate linked moiety X)-type motif 16

46 Gene Product Result for
UniProtKB ID: Q96DE0, B4E3B4, E9PED4, F5GYJ1, Q96N82
Gene ID:
Mouse(75686) nudix (nucleoside diphosphate linked moiety X)-type motif 16
Rat(363129) nudix (nucleoside diphosphate linked moiety X)-type motif 16
Thale Cress(820440) nudix hydrolase-like protein 16
domestic cat(101094947) nudix (nucleoside diphosphate linked moiety X)-type motif 16
cow(512320) nudix (nucleoside diphosphate linked moiety X)-type motif 16
dog(610721) nudix (nucleoside diphosphate linked moiety X)-type motif 16
sheep(654329) nudix (nucleoside diphosphate linked moiety X)-type motif 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152395 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152395 Rosetta Predictions human pricing
NM_001127554 Rosetta Predictions rat pricing
NM_029385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032889 predicted 626
2 SASI_Hs01_00032890 predicted 484
3 SASI_Hs01_00032891 predicted 801
4 SASI_Hs01_00032892 predicted 801
5 SASI_Hs01_00032893 predicted 681
6 SASI_Hs01_00032894 predicted 605
7 SASI_Hs01_00032895 predicted 853
8 SASI_Hs01_00032896 predicted 971
9 SASI_Hs01_00032897 predicted 907
10 SASI_Hs02_00366071 predicted 896
11 SASI_Hs01_00032898 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254293 predicted 770
2 SASI_Rn02_00254294 predicted 694
3 SASI_Rn02_00254295 predicted 894
4 SASI_Rn02_00254296 predicted 877
5 SASI_Rn02_00254297 predicted 685
6 SASI_Rn02_00254298 predicted 826
7 SASI_Rn02_00254299 predicted 892
8 SASI_Rn02_00254300 predicted 834
9 SASI_Rn02_00254301 predicted 919
10 SASI_Rn02_00254302 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058920 predicted 563
2 SASI_Mm01_00058921 predicted 565
3 SASI_Mm01_00058923 predicted 892
4 SASI_Mm01_00058924 predicted 292
5 SASI_Mm01_00058925 predicted 759
6 SASI_Mm01_00058926 predicted 834
7 SASI_Mm02_00335275 predicted 583
8 SASI_Mm01_00058927 predicted 918
9 SASI_Mm01_00058928 predicted 878
10 SASI_Mm01_00058929 predicted 273
11 SASI_Mm01_00058922 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029385
VALIDATED
NUDT16 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 16
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-278s21c1
Sequence:CCGGATGTCTGCCTTCCGCGTTGAACTCGAGTTCAACGCGGAAGGCAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-304s21c1
Sequence:CCGGTGACTACCGCAGCTCACACATCTCGAGATGTGTGAGCTGCGGTAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-563s21c1
Sequence:CCGGCTTCTGGATCCTGGCATTATTCTCGAGAATAATGCCAGGATCCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-590s21c1
Sequence:CCGGCTAAAGATCCCAGATTCTAAGCTCGAGCTTAGAATCTGGGATCTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029385.2-929s21c1
Sequence:CCGGTCCCACTCCTTCCGGGTAAATCTCGAGATTTACCCGGAAGGAGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029385.1-531s1c1
Sequence:CCGGGAGCAACTACTAGAAGCCCTTCTCGAGAAGGGCTTCTAGTAGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029385.1-567s1c1
Sequence:CCGGCTGGATCCTGGCATTATTGCACTCGAGTGCAATAATGCCAGGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029385.1-543s1c1
Sequence:CCGGGAAGCCCTTCAGGACTTGAAACTCGAGTTTCAAGTCCTGAAGGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029385.1-547s1c1
Sequence:CCGGCCCTTCAGGACTTGAAACTTCCTCGAGGAAGTTTCAAGTCCTGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029385
VALIDATED
NUDT16 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 16
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-278s21c1
Sequence:CCGGATGTCTGCCTTCCGCGTTGAACTCGAGTTCAACGCGGAAGGCAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-304s21c1
Sequence:CCGGTGACTACCGCAGCTCACACATCTCGAGATGTGTGAGCTGCGGTAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-563s21c1
Sequence:CCGGCTTCTGGATCCTGGCATTATTCTCGAGAATAATGCCAGGATCCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-590s21c1
Sequence:CCGGCTAAAGATCCCAGATTCTAAGCTCGAGCTTAGAATCTGGGATCTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029385.2-929s21c1
Sequence:CCGGTCCCACTCCTTCCGGGTAAATCTCGAGATTTACCCGGAAGGAGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029385.1-531s1c1
Sequence:CCGGGAGCAACTACTAGAAGCCCTTCTCGAGAAGGGCTTCTAGTAGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029385.1-567s1c1
Sequence:CCGGCTGGATCCTGGCATTATTGCACTCGAGTGCAATAATGCCAGGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029385.1-543s1c1
Sequence:CCGGGAAGCCCTTCAGGACTTGAAACTCGAGTTTCAAGTCCTGAAGGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029385.1-547s1c1
Sequence:CCGGCCCTTCAGGACTTGAAACTTCCTCGAGGAAGTTTCAAGTCCTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029385
VALIDATED
NUDT16 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 16
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-278s21c1
Sequence:CCGGATGTCTGCCTTCCGCGTTGAACTCGAGTTCAACGCGGAAGGCAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-304s21c1
Sequence:CCGGTGACTACCGCAGCTCACACATCTCGAGATGTGTGAGCTGCGGTAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-563s21c1
Sequence:CCGGCTTCTGGATCCTGGCATTATTCTCGAGAATAATGCCAGGATCCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029385.2-590s21c1
Sequence:CCGGCTAAAGATCCCAGATTCTAAGCTCGAGCTTAGAATCTGGGATCTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029385.2-929s21c1
Sequence:CCGGTCCCACTCCTTCCGGGTAAATCTCGAGATTTACCCGGAAGGAGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029385.1-531s1c1
Sequence:CCGGGAGCAACTACTAGAAGCCCTTCTCGAGAAGGGCTTCTAGTAGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029385.1-567s1c1
Sequence:CCGGCTGGATCCTGGCATTATTGCACTCGAGTGCAATAATGCCAGGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029385.1-543s1c1
Sequence:CCGGGAAGCCCTTCAGGACTTGAAACTCGAGTTTCAAGTCCTGAAGGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029385.1-547s1c1
Sequence:CCGGCCCTTCAGGACTTGAAACTTCCTCGAGGAAGTTTCAAGTCCTGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152395
NUDT16 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152395.1-74s1c1
Sequence:CCGGCATACTGATGCAGATGCGCTTCTCGAGAAGCGCATCTGCATCAGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152395.1-505s1c1
Sequence:CCGGGCCTTAAGATTCCAGCTCATCCTCGAGGATGAGCTGGAATCTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152395.1-1426s1c1
Sequence:CCGGGCACGTTAAAGAAGACAGAAACTCGAGTTTCTGTCTTCTTTAACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152395.1-447s1c1
Sequence:CCGGGAGCAGTTACTTGAAGCTCTCCTCGAGGAGAGCTTCAAGTAACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152395.1-2592s1c1
Sequence:CCGGCCGACAGATGTTGAGGAGAATCTCGAGATTCTCCTCAACATCTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152395
NUDT16 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152395.1-74s1c1
Sequence:CCGGCATACTGATGCAGATGCGCTTCTCGAGAAGCGCATCTGCATCAGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152395.1-505s1c1
Sequence:CCGGGCCTTAAGATTCCAGCTCATCCTCGAGGATGAGCTGGAATCTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152395.1-1426s1c1
Sequence:CCGGGCACGTTAAAGAAGACAGAAACTCGAGTTTCTGTCTTCTTTAACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152395.1-447s1c1
Sequence:CCGGGAGCAGTTACTTGAAGCTCTCCTCGAGGAGAGCTTCAAGTAACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152395.1-2592s1c1
Sequence:CCGGCCGACAGATGTTGAGGAGAATCTCGAGATTCTCCTCAACATCTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152395
NUDT16 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152395.1-74s1c1
Sequence:CCGGCATACTGATGCAGATGCGCTTCTCGAGAAGCGCATCTGCATCAGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152395.1-505s1c1
Sequence:CCGGGCCTTAAGATTCCAGCTCATCCTCGAGGATGAGCTGGAATCTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152395.1-1426s1c1
Sequence:CCGGGCACGTTAAAGAAGACAGAAACTCGAGTTTCTGTCTTCTTTAACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152395.1-447s1c1
Sequence:CCGGGAGCAGTTACTTGAAGCTCTCCTCGAGGAGAGCTTCAAGTAACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152395.1-2592s1c1
Sequence:CCGGCCGACAGATGTTGAGGAGAATCTCGAGATTCTCCTCAACATCTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)