EMAIL THIS PAGE TO A FRIEND

NUDT16L1

nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1

50 Gene Product Result for
Synonyms: SDOS
UniProtKB ID: Q9BRJ7, Q8NAI2
Gene ID:
Mouse(66911) nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
Rat(497867) nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
domestic guinea pig(100720660) nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
naked mole-rat(101698587) nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
sheep(101103284) nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
chicken(395557) nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
dog(479862) nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
domestic cat(101093069) nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
cow(518085) nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023171 MISSION® esiRNA esiRNA targeting mouse Nudt16l1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032349 Rosetta Predictions human pricing
NM_001100782 Rosetta Predictions rat pricing
NM_025839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138264 predicted 1030
2 SASI_Hs01_00138265 predicted 711
3 SASI_Hs01_00138266 predicted 289
4 SASI_Hs01_00138267 predicted 691
5 SASI_Hs01_00138269 predicted 911
6 SASI_Hs01_00138270 predicted 921
7 SASI_Hs01_00138271 predicted 1011
8 SASI_Hs01_00138272 predicted 496
9 SASI_Hs01_00138273 predicted 888
10 SASI_Hs02_00359738 predicted 693
11 SASI_Hs01_00138268 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210548 predicted 495
2 SASI_Rn02_00210549 predicted 465
3 SASI_Rn02_00210550 predicted 907
4 SASI_Rn02_00210551 predicted 632
5 SASI_Rn02_00210552 predicted 514
6 SASI_Rn02_00210553 predicted 523
7 SASI_Rn02_00210554 predicted 425
8 SASI_Rn02_00210555 predicted 456
9 SASI_Rn02_00210556 predicted 703
10 SASI_Rn02_00210557 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030728 predicted 535
2 SASI_Mm01_00030729 predicted 982
3 SASI_Mm01_00030730 predicted 485
4 SASI_Mm01_00030731 predicted 913
5 SASI_Mm01_00030732 predicted 548
6 SASI_Mm01_00030733 predicted 618
7 SASI_Mm01_00030734 predicted 445
8 SASI_Mm02_00329115 predicted 960
9 SASI_Mm01_00030735 predicted 827
10 SASI_Mm01_00030736 predicted 1000
11 SASI_Mm01_00030727 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032349
VALIDATED
NUDT16L1 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032349.2-1138s1c1
Sequence:CCGGGTTGTTGGATTTACTTTGCTACTCGAGTAGCAAAGTAAATCCAACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179905    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032349.2-885s1c1
Sequence:CCGGCCTCAGGATGCTCTTGTTTATCTCGAGATAAACAAGAGCATCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-160s21c1
Sequence:CCGGGTGCTGATGCAGATGCGTTTCCTCGAGGAAACGCATCTGCATCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-518s21c1
Sequence:CCGGCTAAGTGCCAGCTCCTCTTTGCTCGAGCAAAGAGGAGCTGGCACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-486s21c1
Sequence:CCGGCAACTTCCTGAGCAACGCCTTCTCGAGAAGGCGTTGCTCAGGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-1143s21c1
Sequence:CCGGTGGATTTACTTTGCTAGATTTCTCGAGAAATCTAGCAAAGTAAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032349.2-540s21c1
Sequence:CCGGCCTCAAGGTGCTCAACATGATCTCGAGATCATGTTGAGCACCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032349
VALIDATED
NUDT16L1 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032349.2-1138s1c1
Sequence:CCGGGTTGTTGGATTTACTTTGCTACTCGAGTAGCAAAGTAAATCCAACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179905    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032349.2-885s1c1
Sequence:CCGGCCTCAGGATGCTCTTGTTTATCTCGAGATAAACAAGAGCATCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-160s21c1
Sequence:CCGGGTGCTGATGCAGATGCGTTTCCTCGAGGAAACGCATCTGCATCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-518s21c1
Sequence:CCGGCTAAGTGCCAGCTCCTCTTTGCTCGAGCAAAGAGGAGCTGGCACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-486s21c1
Sequence:CCGGCAACTTCCTGAGCAACGCCTTCTCGAGAAGGCGTTGCTCAGGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-1143s21c1
Sequence:CCGGTGGATTTACTTTGCTAGATTTCTCGAGAAATCTAGCAAAGTAAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032349.2-540s21c1
Sequence:CCGGCCTCAAGGTGCTCAACATGATCTCGAGATCATGTTGAGCACCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032349
VALIDATED
NUDT16L1 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032349.2-1138s1c1
Sequence:CCGGGTTGTTGGATTTACTTTGCTACTCGAGTAGCAAAGTAAATCCAACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179905    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032349.2-885s1c1
Sequence:CCGGCCTCAGGATGCTCTTGTTTATCTCGAGATAAACAAGAGCATCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-160s21c1
Sequence:CCGGGTGCTGATGCAGATGCGTTTCCTCGAGGAAACGCATCTGCATCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-518s21c1
Sequence:CCGGCTAAGTGCCAGCTCCTCTTTGCTCGAGCAAAGAGGAGCTGGCACTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-486s21c1
Sequence:CCGGCAACTTCCTGAGCAACGCCTTCTCGAGAAGGCGTTGCTCAGGAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_032349.2-1143s21c1
Sequence:CCGGTGGATTTACTTTGCTAGATTTCTCGAGAAATCTAGCAAAGTAAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032349.2-540s21c1
Sequence:CCGGCCTCAAGGTGCTCAACATGATCTCGAGATCATGTTGAGCACCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025839
VALIDATED
NUDT16L1 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-620s1c1
Sequence:CCGGGAGAAGCAGAAGAAGGCTCTACTCGAGTAGAGCCTTCTTCTGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-166s1c1
Sequence:CCGGCATGCGTTTCTCAGTGCTGATCTCGAGATCAGCACTGAGAAACGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-534s1c1
Sequence:CCGGCTGCCAAATATCAACTTCTATCTCGAGATAGAAGTTGATATTTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-741s1c1
Sequence:CCGGGCCTTCTAGTGTGTTTGCTTTCTCGAGAAAGCAAACACACTAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-985s1c1
Sequence:CCGGCCACTTGGTTGGAACACAGATCTCGAGATCTGTGTTCCAACCAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025839.1-301s1c1
Sequence:CCGGCCTTACCGAAGCTGATTACCTCTCGAGAGGTAATCAGCTTCGGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025839.3-297s21c1
Sequence:CCGGACGCCTTACCGAAGCTGATTACTCGAGTAATCAGCTTCGGTAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025839.3-1045s21c1
Sequence:CCGGCGTTAGACCAACCCTTCTTTCCTCGAGGAAAGAAGGGTTGGTCTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025839.3-555s21c1
Sequence:CCGGTGCCCTTAAGGTACTCAACATCTCGAGATGTTGAGTACCTTAAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025839.3-491s21c1
Sequence:CCGGTAGGCGGCTTTCCTAACTTTCCTCGAGGAAAGTTAGGAAAGCCGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025839.3-108s21c1
Sequence:CCGGTTCATGCCACGCCATGCTATACTCGAGTATAGCATGGCGTGGCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025839
VALIDATED
NUDT16L1 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-620s1c1
Sequence:CCGGGAGAAGCAGAAGAAGGCTCTACTCGAGTAGAGCCTTCTTCTGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-166s1c1
Sequence:CCGGCATGCGTTTCTCAGTGCTGATCTCGAGATCAGCACTGAGAAACGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-534s1c1
Sequence:CCGGCTGCCAAATATCAACTTCTATCTCGAGATAGAAGTTGATATTTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-741s1c1
Sequence:CCGGGCCTTCTAGTGTGTTTGCTTTCTCGAGAAAGCAAACACACTAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-985s1c1
Sequence:CCGGCCACTTGGTTGGAACACAGATCTCGAGATCTGTGTTCCAACCAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025839.1-301s1c1
Sequence:CCGGCCTTACCGAAGCTGATTACCTCTCGAGAGGTAATCAGCTTCGGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025839.3-297s21c1
Sequence:CCGGACGCCTTACCGAAGCTGATTACTCGAGTAATCAGCTTCGGTAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025839.3-1045s21c1
Sequence:CCGGCGTTAGACCAACCCTTCTTTCCTCGAGGAAAGAAGGGTTGGTCTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025839.3-555s21c1
Sequence:CCGGTGCCCTTAAGGTACTCAACATCTCGAGATGTTGAGTACCTTAAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025839.3-491s21c1
Sequence:CCGGTAGGCGGCTTTCCTAACTTTCCTCGAGGAAAGTTAGGAAAGCCGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025839.3-108s21c1
Sequence:CCGGTTCATGCCACGCCATGCTATACTCGAGTATAGCATGGCGTGGCATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025839
VALIDATED
NUDT16L1 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-620s1c1
Sequence:CCGGGAGAAGCAGAAGAAGGCTCTACTCGAGTAGAGCCTTCTTCTGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-166s1c1
Sequence:CCGGCATGCGTTTCTCAGTGCTGATCTCGAGATCAGCACTGAGAAACGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-534s1c1
Sequence:CCGGCTGCCAAATATCAACTTCTATCTCGAGATAGAAGTTGATATTTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-741s1c1
Sequence:CCGGGCCTTCTAGTGTGTTTGCTTTCTCGAGAAAGCAAACACACTAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025839.1-985s1c1
Sequence:CCGGCCACTTGGTTGGAACACAGATCTCGAGATCTGTGTTCCAACCAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025839.1-301s1c1
Sequence:CCGGCCTTACCGAAGCTGATTACCTCTCGAGAGGTAATCAGCTTCGGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025839.3-297s21c1
Sequence:CCGGACGCCTTACCGAAGCTGATTACTCGAGTAATCAGCTTCGGTAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025839.3-1045s21c1
Sequence:CCGGCGTTAGACCAACCCTTCTTTCCTCGAGGAAAGAAGGGTTGGTCTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025839.3-555s21c1
Sequence:CCGGTGCCCTTAAGGTACTCAACATCTCGAGATGTTGAGTACCTTAAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025839.3-491s21c1
Sequence:CCGGTAGGCGGCTTTCCTAACTTTCCTCGAGGAAAGTTAGGAAAGCCGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025839.3-108s21c1
Sequence:CCGGTTCATGCCACGCCATGCTATACTCGAGTATAGCATGGCGTGGCATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)