EMAIL THIS PAGE TO A FRIEND

NUDT17

nudix (nucleoside diphosphate linked moiety X)-type motif 17

41 Gene Product Result for
UniProtKB ID: P0C025
Gene ID:
Mouse(78373) nudix (nucleoside diphosphate linked moiety X)-type motif 17
Rat(502584) nudix (nucleoside diphosphate linked moiety X)-type motif 17
Thale Cress(814696) nudix hydrolase 17
Zebrafish(556651) nudix (nucleoside diphosphate linked moiety X)-type motif 17
cow(507315) nudix (nucleoside diphosphate linked moiety X)-type motif 17
Horse(100065696) nudix (nucleoside diphosphate linked moiety X)-type motif 17
domestic cat(101086164) nudix (nucleoside diphosphate linked moiety X)-type motif 17
dog(608260) nudix (nucleoside diphosphate linked moiety X)-type motif 17
sheep(101114485) nudix (nucleoside diphosphate linked moiety X)-type motif 17
naked mole-rat(101700935) nudix (nucleoside diphosphate linked moiety X)-type motif 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012758 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049901 MISSION® esiRNA esiRNA human NUDT17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012758 Rosetta Predictions human pricing
NM_001109340 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029760 predicted 828
2 SASI_Hs01_00029761 predicted 304
3 SASI_Hs01_00029762 predicted 305
4 SASI_Hs01_00029764 predicted 619
5 SASI_Hs01_00029765 predicted 770
6 SASI_Hs01_00029766 predicted 312
7 SASI_Hs01_00029767 predicted 472
8 SASI_Hs01_00029768 predicted 565
9 SASI_Hs01_00029769 predicted 637
10 SASI_Hs02_00306246 predicted 504
11 SASI_Hs01_00029763 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247464 predicted 398
2 SASI_Rn02_00247465 predicted 603
3 SASI_Rn02_00247466 predicted 346
4 SASI_Rn02_00247467 predicted 315
5 SASI_Rn02_00247468 predicted 198
6 SASI_Rn02_00247469 predicted 623
7 SASI_Rn02_00247470 predicted 725
8 SASI_Rn02_00247471 predicted 840
9 SASI_Rn02_00247472 predicted 744
10 SASI_Rn02_00247473 predicted 426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012758
NUDT17 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 17
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-532s1c1
Sequence:CCGGGTTTACCCAAATACCATCACACTCGAGTGTGATGGTATTTGGGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-747s1c1
Sequence:CCGGGAACTAGAGGAGGATGGAAGACTCGAGTCTTCCATCCTCCTCTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-823s1c1
Sequence:CCGGCAGAGGACAAAGAGAGAGTCACTCGAGTGACTCTCTCTTTGTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-611s1c1
Sequence:CCGGCCAACCAAACCCAAATGAGGTCTCGAGACCTCATTTGGGTTTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-313s1c1
Sequence:CCGGGCGACAAGACTGTCTTGCTAACTCGAGTTAGCAAGACAGTCTTGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-537s1c1
Sequence:CCGGCCCAAATACCATCACATTGTTCTCGAGAACAATGTGATGGTATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012758
NUDT17 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 17
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-532s1c1
Sequence:CCGGGTTTACCCAAATACCATCACACTCGAGTGTGATGGTATTTGGGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-747s1c1
Sequence:CCGGGAACTAGAGGAGGATGGAAGACTCGAGTCTTCCATCCTCCTCTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-823s1c1
Sequence:CCGGCAGAGGACAAAGAGAGAGTCACTCGAGTGACTCTCTCTTTGTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-611s1c1
Sequence:CCGGCCAACCAAACCCAAATGAGGTCTCGAGACCTCATTTGGGTTTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-313s1c1
Sequence:CCGGGCGACAAGACTGTCTTGCTAACTCGAGTTAGCAAGACAGTCTTGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-537s1c1
Sequence:CCGGCCCAAATACCATCACATTGTTCTCGAGAACAATGTGATGGTATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012758
NUDT17 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 17
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-532s1c1
Sequence:CCGGGTTTACCCAAATACCATCACACTCGAGTGTGATGGTATTTGGGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-747s1c1
Sequence:CCGGGAACTAGAGGAGGATGGAAGACTCGAGTCTTCCATCCTCCTCTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-823s1c1
Sequence:CCGGCAGAGGACAAAGAGAGAGTCACTCGAGTGACTCTCTCTTTGTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-611s1c1
Sequence:CCGGCCAACCAAACCCAAATGAGGTCTCGAGACCTCATTTGGGTTTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-313s1c1
Sequence:CCGGGCGACAAGACTGTCTTGCTAACTCGAGTTAGCAAGACAGTCTTGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012758.1-537s1c1
Sequence:CCGGCCCAAATACCATCACATTGTTCTCGAGAACAATGTGATGGTATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)