EMAIL THIS PAGE TO A FRIEND

NUDT18

nudix (nucleoside diphosphate linked moiety X)-type motif 18

131 Gene Product Result for
Synonyms: MTH3
UniProtKB ID: Q6ZVK8, Q8IZ75, Q9H687
Gene ID:
Human(79873) Summary: The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. This protein contains a Nudix hydrolase domain and hydrolyzes oxidized forms of guanosine and deoxyguanosine diphosphates. [provided by RefSeq, Sep 2012]
Mouse(213484) nudix (nucleoside diphosphate linked moiety X)-type motif 18
Rat(361068) nudix (nucleoside diphosphate linked moiety X)-type motif 18
domestic guinea pig(100727909) nudix (nucleoside diphosphate linked moiety X)-type motif 18
naked mole-rat(101710430) nudix (nucleoside diphosphate linked moiety X)-type motif 18
sheep(101117473) nudix (nucleoside diphosphate linked moiety X)-type motif 18
Thale Cress(838051) nudix hydrolase 18
Zebrafish(550541) nudix (nucleoside diphosphate linked moiety X)-type motif 18
dog(609139) nudix (nucleoside diphosphate linked moiety X)-type motif 18
cow(509535) nudix (nucleoside diphosphate linked moiety X)-type motif 18
domestic cat(101090347) nudix (nucleoside diphosphate linked moiety X)-type motif 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024815 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024815 Rosetta Predictions human pricing
NM_001100732 Rosetta Predictions rat pricing
NM_153136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203992 predicted 1224
2 SASI_Hs02_00357370 predicted 1057
3 SASI_Hs01_00203995 predicted 490
4 SASI_Hs02_00357371 predicted 1065
5 SASI_Hs02_00357372 predicted 1176
6 SASI_Hs01_00203999 predicted 1157
7 SASI_Hs02_00357373 predicted 1169
8 SASI_Hs02_00357374 predicted 576
9 SASI_Hs02_00357375 predicted 585
10 SASI_Hs02_00357376 predicted 507
11 SASI_Hs01_00203991 predicted 1403
12 SASI_Hs01_00203993 predicted 1582
13 SASI_Hs01_00203994 predicted 319
14 SASI_Hs01_00203996 predicted 2009
15 SASI_Hs01_00203997 predicted 1448
16 SASI_Hs01_00203998 predicted 1632
17 SASI_Hs01_00204000 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210408 predicted 381
2 SASI_Rn02_00210409 predicted 785
3 SASI_Rn02_00210410 predicted 1157
4 SASI_Rn02_00210411 predicted 453
5 SASI_Rn02_00210412 predicted 327
6 SASI_Rn02_00210413 predicted 789
7 SASI_Rn02_00210414 predicted 213
8 SASI_Rn02_00210415 predicted 606
9 SASI_Rn02_00210416 predicted 1045
10 SASI_Rn02_00210417 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125314 predicted 815
2 SASI_Mm01_00125315 predicted 314
3 SASI_Mm01_00125316 predicted 258
4 SASI_Mm01_00125317 predicted 1143
5 SASI_Mm01_00125318 predicted 237
6 SASI_Mm01_00125319 predicted 406
7 SASI_Mm01_00125320 predicted 591
8 SASI_Mm01_00125321 predicted 210
9 SASI_Mm01_00125322 predicted 802
10 SASI_Mm01_00125323 predicted 1187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024815
VALIDATED
NUDT18 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 18
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024815.3-278s21c1
Sequence:CCGGGCAGGATGAGGTGCTACTGATCTCGAGATCAGTAGCACCTCATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024815.3-1173s21c1
Sequence:CCGGCTGGCGATCAGGGATCTTGTTCTCGAGAACAAGATCCCTGATCGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024815.3-1071s21c1
Sequence:CCGGGTTGTCCCAGTGAACAGATAGCTCGAGCTATCTGTTCACTGGGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024815.2-1732s1c1
Sequence:CCGGCTTCTCTTGGTGGAAGGTGATCTCGAGATCACCTTCCACCAAGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024815.2-246s1c1
Sequence:CCGGCGGGCCATGTGACATTTATAACTCGAGTTATAAATGTCACATGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024815.2-320s1c1
Sequence:CCGGGCCATTGTGTGTTTACGGCAACTCGAGTTGCCGTAAACACACAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024815.2-1633s1c1
Sequence:CCGGCCGAGATCACAGTGATGGCATCTCGAGATGCCATCACTGTGATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024815
VALIDATED
NUDT18 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 18
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024815.3-278s21c1
Sequence:CCGGGCAGGATGAGGTGCTACTGATCTCGAGATCAGTAGCACCTCATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024815.3-1173s21c1
Sequence:CCGGCTGGCGATCAGGGATCTTGTTCTCGAGAACAAGATCCCTGATCGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024815.3-1071s21c1
Sequence:CCGGGTTGTCCCAGTGAACAGATAGCTCGAGCTATCTGTTCACTGGGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024815.2-1732s1c1
Sequence:CCGGCTTCTCTTGGTGGAAGGTGATCTCGAGATCACCTTCCACCAAGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024815.2-246s1c1
Sequence:CCGGCGGGCCATGTGACATTTATAACTCGAGTTATAAATGTCACATGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024815.2-320s1c1
Sequence:CCGGGCCATTGTGTGTTTACGGCAACTCGAGTTGCCGTAAACACACAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024815.2-1633s1c1
Sequence:CCGGCCGAGATCACAGTGATGGCATCTCGAGATGCCATCACTGTGATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024815
VALIDATED
NUDT18 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 18
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024815.3-278s21c1
Sequence:CCGGGCAGGATGAGGTGCTACTGATCTCGAGATCAGTAGCACCTCATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024815.3-1173s21c1
Sequence:CCGGCTGGCGATCAGGGATCTTGTTCTCGAGAACAAGATCCCTGATCGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024815.3-1071s21c1
Sequence:CCGGGTTGTCCCAGTGAACAGATAGCTCGAGCTATCTGTTCACTGGGACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024815.2-1732s1c1
Sequence:CCGGCTTCTCTTGGTGGAAGGTGATCTCGAGATCACCTTCCACCAAGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024815.2-246s1c1
Sequence:CCGGCGGGCCATGTGACATTTATAACTCGAGTTATAAATGTCACATGGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024815.2-320s1c1
Sequence:CCGGGCCATTGTGTGTTTACGGCAACTCGAGTTGCCGTAAACACACAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024815.2-1633s1c1
Sequence:CCGGCCGAGATCACAGTGATGGCATCTCGAGATGCCATCACTGTGATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153136
VALIDATED
NUDT18 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 18
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-640s1c1
Sequence:CCGGGTTCTCAAGACTTCCAAAGATCTCGAGATCTTTGGAAGTCTTGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-1450s1c1
Sequence:CCGGCCATCTTTGTCCACTTTGGAACTCGAGTTCCAAAGTGGACAAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-759s1c1
Sequence:CCGGCAAATTCTGCCAACAAGCCATCTCGAGATGGCTTGTTGGCAGAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-1296s1c1
Sequence:CCGGGTCAGGGATCTCATTGCACATCTCGAGATGTGCAATGAGATCCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153136.1-717s1c1
Sequence:CCGGGCTTAGAGCCCATGATGTTCTCTCGAGAGAACATCATGGGCTCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153136.1-978s1c1
Sequence:CCGGGTGTCTGACTCTGCACAGTTTCTCGAGAAACTGTGCAGAGTCAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153136
VALIDATED
NUDT18 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 18
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-640s1c1
Sequence:CCGGGTTCTCAAGACTTCCAAAGATCTCGAGATCTTTGGAAGTCTTGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-1450s1c1
Sequence:CCGGCCATCTTTGTCCACTTTGGAACTCGAGTTCCAAAGTGGACAAAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-759s1c1
Sequence:CCGGCAAATTCTGCCAACAAGCCATCTCGAGATGGCTTGTTGGCAGAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-1296s1c1
Sequence:CCGGGTCAGGGATCTCATTGCACATCTCGAGATGTGCAATGAGATCCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153136.1-717s1c1
Sequence:CCGGGCTTAGAGCCCATGATGTTCTCTCGAGAGAACATCATGGGCTCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153136.1-978s1c1
Sequence:CCGGGTGTCTGACTCTGCACAGTTTCTCGAGAAACTGTGCAGAGTCAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153136
VALIDATED
NUDT18 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 18
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-640s1c1
Sequence:CCGGGTTCTCAAGACTTCCAAAGATCTCGAGATCTTTGGAAGTCTTGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-1450s1c1
Sequence:CCGGCCATCTTTGTCCACTTTGGAACTCGAGTTCCAAAGTGGACAAAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-759s1c1
Sequence:CCGGCAAATTCTGCCAACAAGCCATCTCGAGATGGCTTGTTGGCAGAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153136.1-1296s1c1
Sequence:CCGGGTCAGGGATCTCATTGCACATCTCGAGATGTGCAATGAGATCCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153136.1-717s1c1
Sequence:CCGGGCTTAGAGCCCATGATGTTCTCTCGAGAGAACATCATGGGCTCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153136.1-978s1c1
Sequence:CCGGGTGTCTGACTCTGCACAGTTTCTCGAGAAACTGTGCAGAGTCAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)